User talk:ElNando888/Self-interacting sequences
== Documented candidates ==
=== Candidate 1 ===
==== Raw data ====
<tbody> </tbody>Sequence | AAGUGAACUAUGGGAGCCCUGGGAGGCUCCUCCUGCUGUUCCCAGACAGCAAAAGCCUGUUGG |
|
MFE (Vienna 2.1.1) |
|
-21.7 |
Fully constrained |
|
-19.4 |
Constraint hairpin 1 |
|
-20.5 |
Constraint hairpin 2 |
|
-19.4 |
Hairpins seq. paired |
|
-15.8 |
==== 2D and 3D shots ====
(coming soon)
==== Comments ====
- The delta between the MFE and the hairpins form is both low (hopefully helping the targeted 'pseudo-switching' behavior) and large enough to make it clear that the experiment failed if the 'pseudo-switching' should not occur at all.
- The formation of either of the hairpins (and its possible kissing complex forming) should result in the other hairpin forming as well.
- The form with the hairpin sequences forming a stack is comparatively unlikely (high kcal delta)
== Other examples ==
(need re-analysis)
=== Candidate 1 ===
<tbody> </tbody>Sequence | AAACAGUUGGCUUGAGCCCUGGGAGGCUCUGAGGCUGUUCCCAGACAGCUGAGGGUGGCCAUC |
MFE (Vienna 2.1.1) |
.......(((((...(((((.((..(.((((.((.....)))))))..)).)))))))))).. |
Constrained folding | .......(((((..((((......))))((..((((((......))))))..))..))))).. |
Coaxial stacking predicted for the constrained form:
<tbody> </tbody>
=== Candidate 2 ===
<tbody> </tbody>Sequence | AUGCUUCCCCUGGGAGCCCUGGGAGGCUCACAGGCUGUUCCCAGACAGCACGGCAAAUAAGGU |
MFE (Vienna 2.1.1) |
.((((....((((((((((((.........))))..))))))))..))))............. |
Constrained folding | .((((....(((.(((((......))))).)))(((((......)))))..))))........ |
=== Candidate 3 ===
<tbody> </tbody>Sequence | AGUAAUCGAAUAUGAGCCCUGGGAGGCUCUGUUGCUGUUCCCAGACAGCGUCCCUGGCUCUAG |
MFE (Vienna 2.1.1) |
.............(((((..((((.((((((..........))))..)).)))).)))))... |
Constrained folding | ........((((.(((((......)))))))))(((((......))))).............. |
=== Candidate 4 ===
<tbody> </tbody>Sequence | GCGAAGGGAUAAUGAGCCCUGGGAGGCUCCUUGGCUGUUCCCAGACAGCAAAAUGAGUAUUUU |
MFE (Vienna 2.1.1) |
((...((((.....((((..((((...)))).))))..)))).....)).............. |
Constrained folding | .........(((.(((((......))))).)))(((((......))))).............. |
=== Candidate 5 ===
<tbody> </tbody>Sequence | CGUCCCGCUUGUCGAGCCCUGGGAGGCUCUGGCGCUGUUCCCAGACAGCUGUCCCAUGGAAUG |
MFE (Vienna 2.1.1) |
......((((...))))(((((((((((((((........)))))..))).))))).)).... |
Constrained folding | ..........((((((((......))))).)))(((((......)))))..(((...)))... |
Coaxial stacking predicted for the constrained form:
=== Candidate 6 ===
Sequence | UUAAGAACCGAGGGAGCCCUGGGAGGCUCGGUCUGCUGUUCCCAGACAGCCGUAGAAAGAAAC |
MFE (Vienna 2.1.1) |
.......((.(((....))).))...(((((.((((((....))).)))))).))........ |
Constrained folding | ...(((.((....(((((......))))))))))(((((......)))))............. |
Coaxial stacking is not predicted to occur, but the hairpins (marked in white) seem to be predicted to stay distant from each other.