User:ElNando888/Self-interacting sequences

From Eterna Wiki

(work in progress)

 

 

== The origin of the idea ==

In the future, EteRNA players will face the challenge of creating RNA sequences that can change shape by binding other RNAs rather than reacting to ligands like FMN or Theophylline.

 

A well-known interaction, HIV TAR-TAR*

PDB accession 1KIS.

 

== The goal ==

Attempt to find out under which conditions, the hairpins form can be more stable than the MFE, or in other words, find out whether such sequences can dimerize with itself by forming kissing hairpin complexes, and attempt to quantify the associated kcal bonus.

 

== Parameters for candidates ==

 

"Natural" folding (MFE) should

- not have the hairpin features

- not have the complementary hairpin sequences bound together

 

Constrained folding should

- have the hairpin features

- have as few free bases as possible in the portion inbetween (in an attempt to guarantee that the stems will coaxially stack, thereby nullifying risks of pseudoknot formation)

 

Nice to have

- constraining only one of the hairpins results in the second one forming naturally

- the form where the hairpin sequences pair together should be as unlikely as possible, compared to the other forms

 

== Candidates ==

=== Candidate 1 ===

==== Raw data ====

<tbody> </tbody>
Sequence GGAAAGUGCGAGGGACCAGAGCCCUGGGAGGCUCUGAGGGCUGUUCCCAGACAGCUUCGACCUAGCUGGCUGAGCUUCGGCUCAGCAAAAGAAACAACAACAACAAC  
MFE
(Vienna 2.1.1) 

...........((((..(.((((((.(((...))).)))))).)))))...(((((.......)))))(((((((....))))))).....................

-39.9
Fully constrained

.......................xxxxxx...............xxxxxx.........................................................

.......((.(((...(((((((......))))))).(((((((......)))))))...))).))..(((((((....))))))).....................

-36.2
Constraint hairpin 1

.......................xxxxxx..............................................................................

.......((.(((...(((((((......))))))).((((((((....))))))))...))).))..(((((((....))))))).....................

-37.3
Constraint hairpin 2 

............................................xxxxxx.........................................................

.......((.(((...(((((((......))))))).(((((((......)))))))...))).))..(((((((....))))))).....................

-36.2
Hairpins seq. paired

.......................((((((...............)))))).........................................................

.......((.(((.....((((.(((((((((((...)))))..))))))...))))...))).))..(((((((....))))))).....................

-36.1

 

==== 2D and 3D shots ====

(coming soon)

 

==== Comments ====