User:ElNando888/Self-interacting sequences
(work in progress)
== The idea ==
In the future, EteRNA players will face the challenge of creating RNA sequences that can change shape by binding other RNAs rather than reacting to ligands like FMN or Theophylline.
A well-known interaction HIV TAR-TAR*
== The goal ==
Attempt to find out under which conditions, the hairpins form can be more stable than the MFE, and attempt to quantify the associated kcal bonus.
== Parameters for candidates ==
"Natural" folding (MFE) should
- not have the hairpin features
- not have the complementary hairpin sequences bound together
Constrained folding should
- have the hairpin features
- have as few free bases as possible in the portion inbetween (in an attempt to guarantee that the stems will coaxially stack, thereby nullifying risks of pseudoknot formation)
== Examples ==
=== Candidate 1 ===
<tbody> </tbody>Sequence | AAACAGUUGGCUUGAGCCCUGGGAGGCUCUGAGGCUGUUCCCAGACAGCUGAGGGUGGCCAUC |
MFE (Vienna 2.1.1) |
.......(((((...(((((.((..(.((((.((.....)))))))..)).)))))))))).. |
Constrained folding | .......(((((..((((......))))((..((((((......))))))..))..))))).. |