User:ElNando888/Self-interacting sequences

From Eterna Wiki

(work in progress)

 

 

== The idea ==

In the future, EteRNA players will face the challenge of creating RNA sequences that can change shape by binding other RNAs rather than reacting to ligands like FMN or Theophylline.

 

A well-known interaction HIV TAR-TAR*

PDB accession 1KIS.

 

 

== Parameters for candidates ==

 

"Natural" folding (MFE) should

- not have the hairpin features

- not have the complementary sequences bound

 

Constrained folding should

- have the hairpin features

- have as few free bases as possible in the portion inbetween (in an attempt to guarantee that the stems will coaxially stack, thereby nullifying risks of pseudoknot formation)

 

 

== Examples ==

=== Candidate 1 ===

<tbody> </tbody>
Sequence AAACAGUUGGCUUGAGCCCUGGGAGGCUCUGAGGCUGUUCCCAGACAGCUGAGGGUGGCCAUC
MFE
(Vienna 2.1.1) 
.......(((((...(((((.((..(.((((.((.....)))))))..)).))))))))))..
Constrained folding .......(((((..((((......))))((..((((((......))))))..))..)))))..

 

Pseudo-switch.png