User:ElNando888/Self-interacting sequences: Difference between revisions

From Eterna Wiki
mNo edit summary
mNo edit summary
Line 36: Line 36:
<p>&nbsp;</p>
<p>&nbsp;</p>
<p>Examples presented below are only training samples. When the lab goes live (which will have to wait until admin selection is an actual option), these experimental designs will have to be generated while taking barcodes into account. I'm [[/Script code|currently scripting this]]...</p>
<p>Examples presented below are only training samples. When the lab goes live (which will have to wait until admin selection is an actual option), these experimental designs will have to be generated while taking barcodes into account. I'm [[/Script code|currently scripting this]]...</p>
<p>&nbsp;</p>
<p>== "Seed" lab shape ideas ==</p>
<p>=== Shape 1 ===</p>
<p>[[File:pseudoswitch-seed-lab1.png|400px]]</p>
<p>Trying to combine the KHC aspect of the project with mismatch mediated coaxial stacking. Of course, the idea is that designer attempt to make base 53 pair non-canonically with base 32, and stack between base 10 and 52.</p>
<p>This may need changing the length of the legs, as this multiloop seems flexible enough for pseudoknot formation...</p>
<p>&nbsp;</p>
<p>&nbsp;</p>
<p>== Candidates ==</p>
<p>== Candidates ==</p>

Revision as of 15:43, 30 May 2013

(work in progress)

 

 

== The origin of the idea ==

In the future, EteRNA players will face the challenge of creating RNA sequences that can change shape by binding other RNAs rather than reacting to ligands like FMN or Theophylline.

 

A well-known interaction, HIV TAR-TAR*

PDB accession 1KIS.

 

KHC.png

 

== The goal ==

Attempt to find out under which conditions, the hairpins form can be more stable than the MFE, or in other words, find out whether such sequences can dimerize with itself by forming kissing hairpin complexes, and attempt to quantify the associated kcal bonus.

 

 

== Parameters for candidates ==

 

"Natural" folding (MFE) should

- not have the hairpin features

- not have the complementary hairpin sequences bound together

 

Constrained folding should

- have the hairpin features

- have as few free bases as possible in the portion inbetween (in an attempt to guarantee that the stems will coaxially stack, thereby nullifying risks of pseudoknot formation)

 

Nice to have

- constraining only one of the hairpins results in the second one forming naturally

- the form where the hairpin sequences pair together should be as unlikely as possible, compared to the other forms

 

 

== Planned Lab format ==

- A "seed" shape, with hairpins locked. Say, 30 slots. Gives paricipating players an incentive (normal goal, normal scoring, normal rewards), and will seed the solution with hairpins ready to be bound in kissing complexes

- About 10 candidates, similar or better than the ones accumulating below

- Admin selection, otherwise, the 10 "weird" candidates won't get a chance to be synth'ed

 

Examples presented below are only training samples. When the lab goes live (which will have to wait until admin selection is an actual option), these experimental designs will have to be generated while taking barcodes into account. I'm currently scripting this...

 

== "Seed" lab shape ideas ==

=== Shape 1 ===

Pseudoswitch-seed-lab1.png

Trying to combine the KHC aspect of the project with mismatch mediated coaxial stacking. Of course, the idea is that designer attempt to make base 53 pair non-canonically with base 32, and stack between base 10 and 52.

This may need changing the length of the legs, as this multiloop seems flexible enough for pseudoknot formation...

 

== Candidates ==

=== Candidate 1 ===

==== Raw data ====

<tbody> </tbody>
Sequence GGAAAGUGCGAGGGACCAGAGCCCUGGGAGGCUCUGAGGGCUGUUCCCAGACAGCUUCGACCUAGCUGGCUGAGCUUCGGCUCAGCAAAAGAAACAACAACAACAAC  
MFE
(Vienna 2.1.1) 

...........((((..(.((((((.(((...))).)))))).)))))...(((((.......)))))(((((((....))))))).....................

-39.9
Fully constrained

.......................xxxxxx...............xxxxxx.........................................................

.......((.(((...(((((((......))))))).(((((((......)))))))...))).))..(((((((....))))))).....................

-36.2
Constraint hairpin 1

.......................xxxxxx..............................................................................

.......((.(((...(((((((......))))))).((((((((....))))))))...))).))..(((((((....))))))).....................

-37.3
Constraint hairpin 2 

............................................xxxxxx.........................................................

.......((.(((...(((((((......))))))).(((((((......)))))))...))).))..(((((((....))))))).....................

-36.2
Hairpins seq. paired

.......................((((((...............)))))).........................................................

.......((.(((.....((((.(((((((((((...)))))..))))))...))))...))).))..(((((((....))))))).....................

-36.1

 

==== 2D and 3D shots ====

Pseudo-switch7.png

 

<tbody> </tbody>
Pseudo-switch7-3d-mfe.png Pseudo-switch7-3d.png

 

 

==== Comments ====

(...)

 

=== Candidate 2 ===

==== Raw data ====

<tbody> </tbody>
Sequence GGAAAUCGUGAUUGGGAGGAGCCCUGGGAGGCUCGCACCGCUGUUCCCAGACAGCGUAUAGUAUGAGGGCUGAGCUUCGGCUCAGCAAAAGAAACAACAACAACAAC  
MFE
(Vienna 2.1.1) 

......(((..(((((((.(((..((.((...)).))..))).)))))))...)))............(((((((....))))))).....................

-33.9
Fully constrained

.......................xxxxxx...............xxxxxx.........................................................

.....(((((...((...(((((......)))))...))(((((......)))))......)))))..(((((((....))))))).....................

-30.5
Constraint hairpin 1

.......................xxxxxx..............................................................................

.....(((((...((...(((((......)))))...))((((((....))))))......)))))..(((((((....))))))).....................

-31.6
Constraint hairpin 2 

............................................xxxxxx.........................................................

.....(((((...((...(((((......)))))...))(((((......)))))......)))))..(((((((....))))))).....................

-30.5
Hairpins seq. paired

.......................((((((...............)))))).........................................................

.....((((.((((......((.(((((((((.......)))..))))))...))...))))))))..(((((((....))))))).....................

-28.2

 

==== 2D and 3D shots ====

Pseudo-switch8.png

 

<tbody> </tbody>
Pseudo-switch8-3d-mfe.png Pseudo-switch8-3d.png

 

 

==== Comments ====

(...)

 

=== Candidate 3 ===

==== Raw data ====

<tbody> </tbody>
Sequence GGAAAAGACAGGUGACGGGAGCCCUGGGAGGCUCUCCUAGCUGUUCCCAGACAGCUAAAGGAUAGAAGGCUGAGCUUCGGCUCAGCAAAAGAAACAACAACAACAAC  
MFE
(Vienna 2.1.1) 

.........((.((.(((((((.(((((((...)))))))..)))))).).)).))............(((((((....))))))).....................

-34.3
Fully constrained

.......................xxxxxx...............xxxxxx.........................................................

................(((((((......))))))).(((((((......)))))))...........(((((((....))))))).....................

-32.7
Constraint hairpin 1

.......................xxxxxx..............................................................................

................(((((((......))))))).((((((((....))))))))...........(((((((....))))))).....................

-33.8
Constraint hairpin 2 

............................................xxxxxx.........................................................

................(((((((......))))))).(((((((......)))))))...........(((((((....))))))).....................

-32.7
Hairpins seq. paired

.......................((((((...............)))))).........................................................

...............(...(((.((((((((((.....))))..))))))...)))...)........(((((((....))))))).....................

-28.4

 

==== 2D and 3D shots ====

Pseudo-switch9.png

 

<tbody> </tbody>
Pseudo-switch9-3d-mfe.png Pseudo-switch9-3d.png

 

 

==== Comments ====

(...)

 

=== Candidate 4 ===

==== Raw data ====

<tbody> </tbody>
Sequence GGAAAGAUCGAUGUCCGGGAGCCCUGGGAGGCUCCUCCCGCUGUUCCCAGACAGCGCUAAAGUGGAUCGCUGAGCUUCGGCUCAGCAAAAGAAACAACAACAACAAC  
MFE
(Vienna 2.1.1) 

.....((((..((((.((((((..((((((....))))))..)))))).)))).(((....)))))))(((((((....))))))).....................

-40.7
Fully constrained

.......................xxxxxx...............xxxxxx.........................................................

.....((((.((....(((((((......)))))))..((((((......)))))).....)).))))(((((((....))))))).....................

-37.1
Constraint hairpin 1

.......................xxxxxx..............................................................................

.....((((.((....(((((((......)))))))..(((((((....))))))).....)).))))(((((((....))))))).....................

-38.2
Constraint hairpin 2 

............................................xxxxxx.........................................................

.....((((.((....(((((((......)))))))..((((((......)))))).....)).))))(((((((....))))))).....................

-37.1
Hairpins seq. paired

.......................((((((...............)))))).........................................................

.....((((.((.....((.((.(((((((((.......)))..))))))...)).))...)).))))(((((((....))))))).....................

-33.4

 

==== 2D and 3D shots ====

Pseudo-switch10.png

 

<tbody> </tbody>
Pseudo-switch10-3d-mfe.png Pseudo-switch10-3d.png

 

 

==== Comments ====

(...)

 


=== Candidate 5 ===

==== Raw data ====

<tbody> </tbody>
Sequence GGAAAAAUAAGUGUCUAGGAGCCCUGGGAGGCUCUCCAGGCUGUUCCCAGACAGCACGGAUGCAUUACGCUGAGCUUCGGCUCAGCAAAAGAAACAACAACAACAAC  
MFE
(Vienna 2.1.1) 

...........(((((.(((((((((((......))))))..))))).)))))(((....))).....(((((((....))))))).....................

-35.7
Fully constrained

.......................xxxxxx...............xxxxxx.........................................................

.........(((((....(((((......)))))(((..(((((......)))))..))).)))))..(((((((....))))))).....................

-31.5
Constraint hairpin 1

.......................xxxxxx..............................................................................

.........(((((....(((((......)))))(((..((((((....))))))..))).)))))..(((((((....))))))).....................

-32.6
Constraint hairpin 2 

............................................xxxxxx.........................................................

.........(((((....(((((......)))))(((..(((((......)))))..))).)))))..(((((((....))))))).....................

-31.5
Hairpins seq. paired

.......................((((((...............)))))).........................................................

..........((((((.(..((.((((((((((.....))))..))))))...)).))))))).....(((((((....))))))).....................

-31.5

 

==== 2D and 3D shots ====

Pseudo-switch11.png

 

<tbody> </tbody>
Pseudo-switch11-3d-mfe.png Pseudo-switch11-3d.png

 

 

==== Comments ====

(...)

 


=== Candidate 6 ===

==== Raw data ====

<tbody> </tbody>
Sequence GGAAAAAGAUGGAACUGAGAGCCCUGGGAGGCUCCCAUGGCUGUUCCCAGACAGCUGGAACACGGUAAGCUGAGCUUCGGCUCAGCAAAAGAAACAACAACAACAAC  
MFE
(Vienna 2.1.1) 

..........(((((....((((.(((((...))))).)))))))))......((((.....))))..(((((((....))))))).....................

-34
Fully constrained

.......................xxxxxx...............xxxxxx.........................................................

.............((((.(((((......)))))(((..(((((......))))))))....))))..(((((((....))))))).....................

-29.8
Constraint hairpin 1

.......................xxxxxx..............................................................................

.............((((.(((((......)))))(((..((((((....)))))))))....))))..(((((((....))))))).....................

-30.9
Constraint hairpin 2 

............................................xxxxxx.........................................................

.............((((.(((((......)))))(((..(((((......))))))))....))))..(((((((....))))))).....................

-29.8
Hairpins seq. paired

.......................((((((...............)))))).........................................................

.............((((..(((.((((((((((.....))))..))))))...)))......))))..(((((((....))))))).....................

-29

 

==== 2D and 3D shots ====

Pseudo-switch12.png

 

<tbody> </tbody>
Pseudo-switch12-3d-mfe.png Pseudo-switch12-3d.png

 

 

==== Comments ====

(...)

 



=== Candidate 7 ===

==== Raw data ====

<tbody> </tbody>
Sequence GGAAACGAUUCGGAGCCCGAGCCCUGGGAGGCUCUCUGGCGCUGUUCCCAGACAGCCACUGCGAACAAGCUGAGCUUCGGCUCAGCAAAAGAAACAACAACAACAAC  
MFE
(Vienna 2.1.1) 

........((((.((((((.....)))).((((.(((((........))))).)))).)).))))...(((((((....))))))).....................

-34.6
Fully constrained

.......................xxxxxx................xxxxxx........................................................

........((((.((((.(((((......)))))...)).(((((......)))))..)).))))...(((((((....))))))).....................

-31.9
Constraint hairpin 1

.......................xxxxxx..............................................................................

........((((.((((.(((((......)))))...)).((((((....))))))..)).))))...(((((((....))))))).....................

-33
Constraint hairpin 2 

.............................................xxxxxx........................................................

........((((.((((.(((((......)))))...)).(((((......)))))..)).))))...(((((((....))))))).....................

-31.9
Hairpins seq. paired

.......................((((((................))))))........................................................

........((((.((...(.((.(((((((((........)))..))))))...))).)).))))...(((((((....))))))).....................

-29

 

==== 2D and 3D shots ====

Pseudo-switch13.png

 

<tbody> </tbody>
Pseudo-switch13-3d-mfe.png Pseudo-switch13-3d.png

 

 

==== Comments ====

(...)