User:ElNando888/Self-interacting sequences: Difference between revisions
ElNando888 (talk | contribs) mNo edit summary |
ElNando888 (talk | contribs) mNo edit summary |
||
Line 114: | Line 114: | ||
<p> </p> | <p> </p> | ||
<p>[[File:Pseudo-switch4.png|650px]]</p> | <p>[[File:Pseudo-switch4.png|650px]]</p> | ||
<p> </p> | |||
<p>=== Candidate 5 ===</p> | |||
<table border="0" cellpadding="3"> | |||
<tbody> | |||
<tr> | |||
<td>Sequence</td> | |||
<td><code>CGUCCCGCUUGUCGAGCCCUGGGAGGCUCUGGCGCUGUUCCCAGACAGCUGUCCCAUGGAAUG</code></td> | |||
</tr> | |||
<tr> | |||
<td>MFE<br />(Vienna 2.1.1) </td> | |||
<td><code>......((((...))))(((((((((((((((........)))))..))).))))).))....</code></td> | |||
</tr> | |||
<tr> | |||
<td>Constrained folding</td> | |||
<td><code>..........((((((((......))))).)))(((((......)))))..(((...)))...</code></td> | |||
</tr> | |||
</tbody> | |||
</table> | |||
<p> </p> | |||
<p>[[File:Pseudo-switch5.png|650px]]</p> |
Revision as of 07:23, 27 May 2013
(work in progress)
== The idea ==
In the future, EteRNA players will face the challenge of creating RNA sequences that can change shape by binding other RNAs rather than reacting to ligands like FMN or Theophylline.
A well-known interaction, HIV TAR-TAR*
== The goal ==
Attempt to find out under which conditions, the hairpins form can be more stable than the MFE, and attempt to quantify the associated kcal bonus.
== Parameters for candidates ==
"Natural" folding (MFE) should
- not have the hairpin features
- not have the complementary hairpin sequences bound together
Constrained folding should
- have the hairpin features
- have as few free bases as possible in the portion inbetween (in an attempt to guarantee that the stems will coaxially stack, thereby nullifying risks of pseudoknot formation)
== Examples ==
=== Candidate 1 ===
<tbody> </tbody>Sequence | AAACAGUUGGCUUGAGCCCUGGGAGGCUCUGAGGCUGUUCCCAGACAGCUGAGGGUGGCCAUC |
MFE (Vienna 2.1.1) |
.......(((((...(((((.((..(.((((.((.....)))))))..)).)))))))))).. |
Constrained folding | .......(((((..((((......))))((..((((((......))))))..))..))))).. |
Coaxial stacking predicted for the constrained form:
<tbody> </tbody>
=== Candidate 2 ===
<tbody> </tbody>Sequence | AUGCUUCCCCUGGGAGCCCUGGGAGGCUCACAGGCUGUUCCCAGACAGCACGGCAAAUAAGGU |
MFE (Vienna 2.1.1) |
.((((....((((((((((((.........))))..))))))))..))))............. |
Constrained folding | .((((....(((.(((((......))))).)))(((((......)))))..))))........ |
=== Candidate 3 ===
<tbody> </tbody>Sequence | AGUAAUCGAAUAUGAGCCCUGGGAGGCUCUGUUGCUGUUCCCAGACAGCGUCCCUGGCUCUAG |
MFE (Vienna 2.1.1) |
.............(((((..((((.((((((..........))))..)).)))).)))))... |
Constrained folding | ........((((.(((((......)))))))))(((((......))))).............. |
=== Candidate 4 ===
<tbody> </tbody>Sequence | GCGAAGGGAUAAUGAGCCCUGGGAGGCUCCUUGGCUGUUCCCAGACAGCAAAAUGAGUAUUUU |
MFE (Vienna 2.1.1) |
((...((((.....((((..((((...)))).))))..)))).....)).............. |
Constrained folding | .........(((.(((((......))))).)))(((((......))))).............. |
=== Candidate 5 ===
<tbody> </tbody>Sequence | CGUCCCGCUUGUCGAGCCCUGGGAGGCUCUGGCGCUGUUCCCAGACAGCUGUCCCAUGGAAUG |
MFE (Vienna 2.1.1) |
......((((...))))(((((((((((((((........)))))..))).))))).)).... |
Constrained folding | ..........((((((((......))))).)))(((((......)))))..(((...)))... |