User:ElNando888/Self-interacting sequences

(work in progress)

 

 

== The idea ==

In the future, EteRNA players will face the challenge of creating RNA sequences that can change shape by binding other RNAs rather than reacting to ligands like FMN or Theophylline.

 

A well-known interaction HIV TAR-TAR*

PDB accession 1KIS.

 

== The goal ==

Attempt to find out under which conditions, the hairpins form can be more stable than the MFE, and attempt to quantify the associated kcal bonus.

 

== Parameters for candidates ==

 

"Natural" folding (MFE) should

- not have the hairpin features

- not have the complementary hairpin sequences bound together

 

Constrained folding should

- have the hairpin features

- have as few free bases as possible in the portion inbetween (in an attempt to guarantee that the stems will coaxially stack, thereby nullifying risks of pseudoknot formation)

 

 

== Examples ==

=== Candidate 1 ===

<tbody> </tbody>

Sequence	AAACAGUUGGCUUGAGCCCUGGGAGGCUCUGAGGCUGUUCCCAGACAGCUGAGGGUGGCCAUC
MFE (Vienna 2.1.1)	.......(((((...(((((.((..(.((((.((.....)))))))..)).))))))))))..
Constrained folding	.......(((((..((((......))))((..((((((......))))))..))..)))))..

 

 

=== Candidate 2 ===

<tbody> </tbody>

Sequence	AUGCUUCCCCUGGGAGCCCUGGGAGGCUCACAGGCUGUUCCCAGACAGCACGGCAAAUAAGGU
MFE (Vienna 2.1.1)	.((((....((((((((((((.........))))..))))))))..)))).............
Constrained folding	.((((....(((.(((((......))))).)))(((((......)))))..))))........

 

 

=== Candidate 3 ===

<tbody> </tbody>

Sequence	AGUAAUCGAAUAUGAGCCCUGGGAGGCUCUGUUGCUGUUCCCAGACAGCGUCCCUGGCUCUAG
MFE (Vienna 2.1.1)	.............(((((..((((.((((((..........))))..)).)))).)))))...
Constrained folding	........((((.(((((......)))))))))(((((......)))))..............