User:ElNando888/Self-interacting sequences: Difference between revisions
ElNando888 (talk | contribs) mNo edit summary |
ElNando888 (talk | contribs) mNo edit summary |
||
| Line 4: | Line 4: | ||
<p> </p> | <p> </p> | ||
<p>== The idea ==</p> | <p>== The idea ==</p> | ||
<p>In the future, EteRNA players will face the challenge of creating RNA | <p>In the future, EteRNA players will face the challenge of creating RNA [[sequence]]s that can change shape by binding other [[RNA]]s rather than reacting to [[ligand]]s like [[FMN]] or [[Theophylline]].</p> | ||
<p> </p> | <p> </p> | ||
<p>A well-known interaction HIV TAR-TAR*</p> | <p>A well-known interaction HIV TAR-TAR*</p> | ||
<p>PDB accession 1KIS.</p> | <p>[http://www.rcsb.org/pdb/explore.do?structureId=1kis PDB accession 1KIS].</p> | ||
<p> </p> | <p> </p> | ||
<p>== The goal ==</p> | <p>== The goal ==</p> | ||
Revision as of 19:00, 22 May 2013
(work in progress)
== The idea ==
In the future, EteRNA players will face the challenge of creating RNA sequences that can change shape by binding other RNAs rather than reacting to ligands like FMN or Theophylline.
A well-known interaction HIV TAR-TAR*
== The goal ==
Attempt to find out under which conditions, the hairpins form can be more stable than the MFE, and attempt to quantify the associated kcal bonus.
== Parameters for candidates ==
"Natural" folding (MFE) should
- not have the hairpin features
- not have the complementary hairpin sequences bound together
Constrained folding should
- have the hairpin features
- have as few free bases as possible in the portion inbetween (in an attempt to guarantee that the stems will coaxially stack, thereby nullifying risks of pseudoknot formation)
== Examples ==
=== Candidate 1 ===
<tbody> </tbody>| Sequence | AAACAGUUGGCUUGAGCCCUGGGAGGCUCUGAGGCUGUUCCCAGACAGCUGAGGGUGGCCAUC |
| MFE (Vienna 2.1.1) |
.......(((((...(((((.((..(.((((.((.....)))))))..)).)))))))))).. |
| Constrained folding | .......(((((..((((......))))((..((((((......))))))..))..))))).. |
