User:ElNando888/Self-interacting sequences: Difference between revisions

Revision as of 14:53, 22 May 2013

(work in progress)

== The idea ==

In the future, EteRNA players will face the challenge of creating RNA sequences that can change shape by binding other RNAs rather than reacting to ligands like FMN or Theophylline.

A well-known interaction HIV TAR-TAR*

PDB accession 1KIS.

== The goal ==

Attempt to find out under which conditions, the hairpins form can be more stable than the MFE, and attempt to quantify the associated kcal bonus.

== Parameters for candidates ==

"Natural" folding (MFE) should

- not have the hairpin features

- not have the complementary hairpin sequences bound together

Constrained folding should

- have the hairpin features

- have as few free bases as possible in the portion inbetween (in an attempt to guarantee that the stems will coaxially stack, thereby nullifying risks of pseudoknot formation)

== Examples ==

=== Candidate 1 ===

Sequence	`AAACAGUUGGCUUGAGCCCUGGGAGGCUCUGAGGCUGUUCCCAGACAGCUGAGGGUGGCCAUC`
MFE (Vienna 2.1.1)	`.......(((((...(((((.((..(.((((.((.....)))))))..)).))))))))))..`
Constrained folding	`.......(((((..((((......))))((..((((((......))))))..))..)))))..`

@@ Line 9: / Line 9: @@
 <p>PDB accession 1KIS.</p>
 <p>&nbsp;</p>
+<p>== The goal ==</p>
+<p>Attempt to find out under which conditions, the hairpins form can be more stable than the MFE, and attempt to quantify the associated kcal bonus.</p>
 <p>&nbsp;</p>
 <p>== Parameters for candidates ==</p>
@@ Line 14: / Line 16: @@
 <p>"Natural" folding (MFE) should</p>
 <p>- not have the hairpin features</p>
-<p>- not have the complementary sequences bound</p>
+<p>- not have the complementary hairpin sequences bound together</p>
 <p>&nbsp;</p>
 <p>Constrained folding should</p>