User:ElNando888/Self-interacting sequences: Difference between revisions
From Eterna Wiki
ElNando888 (talk | contribs) (Created page with "<p>(work in progress)</p> <p> </p> <p>__TOC__</p> <p> </p> <p>== The idea ==</p> <p>In the future, EteRNA players will face the challenge of creating RNA sequences t...") |
ElNando888 (talk | contribs) mNo edit summary |
||
| Line 23: | Line 23: | ||
<p>== Examples ==</p> | <p>== Examples ==</p> | ||
<p>=== Candidate 1 ===</p> | <p>=== Candidate 1 ===</p> | ||
<p>[[File:Pseudo-switch.png| | <table border="0" cellpadding="3"> | ||
<tbody> | |||
<tr> | |||
<td>Sequence</td> | |||
<td><code>{{ntA}}{{ntA}}{{ntA}}{{ntC}}{{ntA}}{{ntG}}{{ntU}}{{ntU}}{{ntG}}{{ntG}}{{ntC}}{{ntU}}{{ntU}}{{ntG}}{{ntA}}{{ntG}}{{ntC}}{{ntC}}{{ntC}}{{ntU}}{{ntG}}{{ntG}}{{ntG}}{{ntA}}{{ntG}}{{ntG}}{{ntC}}{{ntU}}{{ntC}}{{ntU}}{{ntG}}{{ntA}}{{ntG}}{{ntG}}{{ntC}}{{ntU}}{{ntG}}{{ntU}}{{ntU}}{{ntC}}{{ntC}}{{ntC}}{{ntA}}{{ntG}}{{ntA}}{{ntC}}{{ntA}}{{ntG}}{{ntC}}{{ntU}}{{ntG}}{{ntA}}{{ntG}}{{ntG}}{{ntG}}{{ntU}}{{ntG}}{{ntG}}{{ntC}}{{ntC}}{{ntA}}{{ntU}}{{ntC}}</code></td> | |||
</tr> | |||
<tr> | |||
<td>MFE<br />(Vienna 2.1.1) </td> | |||
<td><code>.......(((((...(((((.((..(.((((.((.....)))))))..)).))))))))))..</code></td> | |||
</tr> | |||
<tr> | |||
<td>Constrained folding</td> | |||
<td><code>.......(((((..((((......))))((..((((((......))))))..))..)))))..</code></td> | |||
</tr> | |||
</tbody> | |||
</table> | |||
<p> </p> | |||
<p>[[File:Pseudo-switch.png|650px]]</p> | |||
Revision as of 14:26, 22 May 2013
(work in progress)
== The idea ==
In the future, EteRNA players will face the challenge of creating RNA sequences that can change shape by binding other RNAs rather than reacting to ligands like FMN or Theophylline.
A well-known interaction HIV TAR-TAR*
PDB accession 1KIS.
== Parameters for candidates ==
"Natural" folding (MFE) should
- not have the hairpin features
- not have the complementary sequences bound
Constrained folding should
- have the hairpin features
- have as few free bases as possible in the portion inbetween (in an attempt to guarantee that the stems will coaxially stack, thereby nullifying risks of pseudoknot formation)
== Examples ==
=== Candidate 1 ===
<tbody> </tbody>| Sequence | AAACAGUUGGCUUGAGCCCUGGGAGGCUCUGAGGCUGUUCCCAGACAGCUGAGGGUGGCCAUC |
| MFE (Vienna 2.1.1) |
.......(((((...(((((.((..(.((((.((.....)))))))..)).)))))))))).. |
| Constrained folding | .......(((((..((((......))))((..((((((......))))))..))..))))).. |
