Suboptimal Structure

From Eterna Wiki

Revision as of 10:38, 31 May 2013 by ElNando888 (talk | contribs) (wikified some more, missing word added, sequence 'coloring')

Alternative, or suboptimal structures are structures that a given sequence could fold into aside from the minimum free energy structure. As an RNA folds, it may pass through several suboptimal structures before it adopts a stable structure. These alternative structures may also exist in equilibrium with one another, and the MFE structure.

Example

The following examples show two suboptimal structures and the minimum free energy structure for the sequence:

GGAAACCGCCCGCGCGGGCGCGGGCGAAAACGCCCGCGAAACCGCCGCGAAAACGCGGCGGCCCGCGCGGGCGGAAAAGAAACAACAACAACAAC

Suboptimal structure #1

Notice that the second suboptimal structure has a rather low value of free energy. Many stable GC pairs would have to be broken in order to bring this from the second suboptimal structure to the minimum free energy structure.

Suboptimal structure #2



MFE structure

This is one of the several downsides of "christmas tree" designs in lab.