Reproducibility Test Lab
From Eterna Wiki
The Reproducibilty Test Lab is a special lab that is (will be) synthesized in each synthesis round. The objectives for this lab are:
- Provide a consistent measure of the reproducibilty of the cloud lab synthesis results, for long term quality control,
- Determine how much of the variation in synthesis results is captured by the error estimates reported for each synthesized base,
- Provide some guidance as to where the synthesis process might be improved, in order to increase reproducibility, and
- Give those analysing the synthesis data a better understanding of the variation to expect when comparing data from differnt synthesis rounds.
Initial Sequences
<tbody> </tbody>| Sequence | Description of rationale for inclusion |
| GUCAUCUACUACGAAAAACACAUUCUAUUCGAAAACGAAUAGAAUGUGUCGUAGUAGAUGACCGUUGCCUUCGGGCAACG |
Cloud Lab 1 representative. Round 1. ID=2366937. Score = 94. |
| GCAAGGACGAAUAAGCCAUAACCGCAGGGAAACACUGAACGGAGCCGAAAGAGCAAGCAAUAACACGAUGUUCGCAUCGU |
Cloud Lab 4 representative. Round 2. ID=2655773. Score = 88. |
|
|
|
