Puzzle Walkthroughs/Basic Switch Walkthrough (chatlog)
From Eterna Wiki
Chat log captured on Dec 24th 2012
<tbody> </tbody>
Kalas | Am I the only one having trouble with switches? |
rnjensen45 | kalas,... join the club |
rnjensen45 | :) |
Quxwozing | yeah |
rnjensen45 | Based on the number of solvers on most switch puzzles, Ii believe it to be a very large club of us mere mortal solvers... |
Kalas | Never paid attention, I'll take a look. ;-) |
jmf028 | i'm not one of em :) |
jmf028 | mere mortals i mean |
rnjensen45 | jmf, you're too humble... |
jmf028 | :D |
jmf028 | sorry |
rnjensen45 | jmf, when are you going to do a guide for solving switches |
jmf028 | merry christmas |
jmf028 | as soon as i finish this switch |
rnjensen45 | cool |
jmf028 | if you want I can show you right now |
rnjensen45 | \ |
rnjensen45 | cool |
jmf028 | id rather not make a written guide |
rnjensen45 | understand |
jmf028 | okay so lets start with basic switch first |
jmf028 | have you solved that yet? |
rnjensen45 | ok |
rnjensen45 | yeah, I actually have 4 or 5 solved. and another 4 close. |
rnjensen45 | my problem is I get close, and can't figure how to finish |
jmf028 | okay well lets go to one you haven't tried yet |
jmf028 | ill guide you through how i solve it |
rnjensen45 | perfect |
jmf028 | and don't pick the jet plane or the only 13 solved ones |
rnjensen45 | :D wouldn't do that |
jmf028 | okay tell me when you found one |
rnjensen45 | actually, can you give me a hint on how I would go about getting this one completed |
rnjensen45 | http://eterna.cmu.edu/sites/default/files/chat_screens/60391_1356385525.png |
jmf028 | alright hold on |
Kalas | hey |
Kalas | I could use a hand here too |
rnjensen45 | I think I have 3 that are about this close... I get to here and can;t figure out. Kalas: CUGAGGAUAUGGAAAACUAGAAGGCGGCACACACACAACACCU |
Kalas | uhghh |
rnjensen45 | sorry kalas, good point, we should |
Kalas | http://eterna.cmu.edu/sites/default/files/chat_screens/11100_1356385575.png |
rnjensen45 | lets do one from the start so this isn't so one sided. |
rnjensen45 | my mistake, sorry kalas |
jmf028 | oh i see |
jmf028 | ok lets go to that one |
rnjensen45 | ok |
jmf028 | alright ready guys? |
Kalas | Yep |
Kalas | I am |
Kalas | ;-) |
jmf028 | cool alright so first we fill in the locked bases partners |
jmf028 | start with locked Adenine |
jmf028 | http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356385708.png |
jmf028 | should look like that |
Kalas | ahhh |
jmf028 | the reason this is the first base you start filling in is because it is the only possible pair you can make with a locked Adenine |
Kalas | So i need to do it over again? |
jmf028 | now |
jmf028 | yes kalas |
Kalas | ok |
Kalas | sad |
Kalas | give me a sec |
jmf028 | if you want to follow this guide correctly |
Kalas | done |
rnjensen45 | me too |
jmf028 | okay so now, do you know how to highlight a base? |
Kalas | no |
rnjensen45 | yes |
rnjensen45 | control click |
jmf028 | hold cntrl for pc and command for mac and click on base |
jmf028 | click on the U you just filled in |
Kalas | k |
jmf028 | is it highlighted with black circle? |
Kalas | yes |
jmf028 | good |
jmf028 | now |
jmf028 | switch to other structure |
Kalas | Im doing it in PiP |
jmf028 | http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356385920.png |
jmf028 | oh well then don't |
Kalas | i see it |
jmf028 | you need to have this one as it allows you to highlight |
jmf028 | otherwise you will have to highlight both structures |
Kalas | okay, i'll do that |
jmf028 | don't get me wrong sometimes PiP mode is necessary |
Kalas | you're right |
jmf028 | but for now lets keep it simple |
Kalas | okay |
jmf028 | okay so the U is in a loop right? |
Kalas | yup |
jmf028 | in this case no pair is to be had in this structure with that U |
jmf028 | so...... |
jmf028 | unhighlight |
jmf028 | XD |
jmf028 | not a word but whatevs |
Kalas | Following instructions |
jmf028 | switch back |
jmf028 | now we will fill in bases next to locked Gs |
Kalas | ok |
jmf028 | do you understand why Gs are a little different than As |
rnjensen45 | yep 2 choices |
jmf028 | gj rnj |
Kalas | A only match with U? |
jmf028 | correct |
jmf028 | well here is my solution |
jmf028 | dont worry about choice right now |
jmf028 | only use GCs |
rnjensen45 | makes sense |
Kalas | To keep 1 choice |
jmf028 | so next to Each one, use a C |
Kalas | done |
jmf028 | and then highlight both |
rnjensen45 | done |
jmf028 | then switch |
Kalas | done |
jmf028 | http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356386202.png |
jmf028 | should look like this so far |
Kalas | yup |
jmf028 | good |
jmf028 | switch back |
Kalas | done |
jmf028 | now usually when no more locked bases, you have to guess |
jmf028 | but here is my strategy |
jmf028 | GCs at loop-stack intersections |
jmf028 | AUs between loops |
jmf028 | so check this out |
Kalas | thats my strat so far |
rnjensen45 | do you have a preference on orientation GC or CG |
jmf028 | http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356386327.png |
Kalas | follow the locked pattern |
jmf028 | in this case |
rnjensen45 | what I have |
jmf028 | this is the best energy orientation for the puzzle |
jmf028 | so far..... |
jmf028 | so |
rnjensen45 | agreed |
jmf028 | now you have to highlight both bases in each pair |
jmf028 | switch then |
jmf028 | http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356386394.png |
jmf028 | should look like this |
rnjensen45 | let me guess, the next step is to put a G in 2 |
jmf028 | yep exactly :) |
jmf028 | but here is where you start having fun |
Kalas | g in 2? |
jmf028 | once you put the G there, switch highlighted C to to the G you just put |
rnjensen45 | yep, Up to this point I am good... it is from here... |
rnjensen45 | Kalas, next to the circled C |
rnjensen45 | http://eterna.cmu.edu/sites/default/files/chat_screens/60391_1356386503.png |
jmf028 | correct |
Kalas | oh |
Kalas | ok |
jmf028 | but remember to switch the highlighted portion from the C to the G and from the U to the already bonded A |
jmf028 | and unhighlight the A and G in the loop |
jmf028 | then switch |
jmf028 | http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356386581.png |
jmf028 | should look like this |
Kalas | indeed |
rnjensen45 | yep |
jmf028 | unhighlight those two bases now, and you have all the bases paired in one structure now |
jmf028 | now lets work on the other structure |
jmf028 | switch |
jmf028 | there are three still unpaired bases in this puzzle |
Kalas | http://eterna.cmu.edu/sites/default/files/chat_screens/11100_1356386666.png |
jmf028 | so remember what i said about intersections and in between the loops? |
Kalas | Yes |
jmf028 | EXACTLY |
jmf028 | good job |
jmf028 | how does the other one look? |
Kalas | bad XD |
jmf028 | okay well hold on |
jmf028 | http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356386728.png |
jmf028 | here is a good structure that keeps the first one stable |
jmf028 | this is not stable |
jmf028 | but it is all paired |
rnjensen45 | agreed |
jmf028 | all 6 of the base pairs need to be highlighted and paired up in other structure |
jmf028 | but since other structure is stable, it looks like they already are :) |
jmf028 | also, when switched again: |
rnjensen45 | so now we need to deal with energy of the structures w/ and w/o the molecule |
jmf028 | http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356386835.png |
jmf028 | notice the G that just so conveniently fell into the boost base near the GC at loop |
Kalas | yes |
rnjensen45 | was just looking at that |
jmf028 | :) |
jmf028 | that is not always what happens |
jmf028 | but still it is good XD |
jmf028 | unhighlight all the bases and now we are on to the switching back and forth part |
rnjensen45 | k |
jmf028 | now lets go to the unstable structure |
jmf028 | http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356386985.png |
jmf028 | notice the end loop has no boost G |
Kalas | indeed |
jmf028 | lets try inserting one and see what it does to brother structure |
Kalas | makes it unstable |
jmf028 | well thats not good |
jmf028 | but hold on |
jmf028 | you can go backwards to undo but lets try something |
jmf028 | http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356387065.png |
jmf028 | in this state here: |
jmf028 | lets try messing around with loop |
jmf028 | one at a time substitute an A for a non A |
jmf028 | if it does not stabilize, undo |
jmf028 | ready go |
Kalas | it did |
jmf028 | good which one |
Kalas | http://eterna.cmu.edu/sites/default/files/chat_screens/11100_1356387140.png |
Kalas | below a g at the right |
rnjensen45 | got the same result |
jmf028 | hold on something is weird |
jmf028 | why is yours different |
jmf028 | http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356387203.png |
jmf028 | this is mine |
Kalas | weird |
jmf028 | ? |
jmf028 | haha |
rnjensen45 | we both changed 14 to U |
Kalas | What about you jensen? |
rnjensen45 | when you said to switch A to non-A in loop |
jmf028 | oh |
Kalas | yup |
rnjensen45 | we started with 14 |
Kalas | 16 i think |
jmf028 | i meant change non A to A |
jmf028 | sorry |
Kalas | oh! |
rnjensen45 | NP |
jmf028 | just go to this solution |
jmf028 | http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356387303.png |
jmf028 | or sequence |
jmf028 | not solution yet |
rnjensen45 | so changing 12 to A also stabilizes |
jmf028 | correct |
jmf028 | now unhighlight G and highlight.....? |
Kalas | http://eterna.cmu.edu/sites/default/files/chat_screens/11100_1356387361.png |
jmf028 | which one are you now going to highlight? |
rnjensen45 | better, we change to A because it connects to fewer |
Kalas | I think i fail to understand this part |
jmf028 | okay hold on kalas |
jmf028 | switch from non A to A |
rnjensen45 | 17 changes to U |
jmf028 | but ONE at a TIME |
jmf028 | so if it doesn't stabilize..... |
Kalas | o |
jmf028 | then undo and try another one |
jmf028 | does that help? |
Kalas | so we make a change in the unstable |
rnjensen45 | sorry, got ahead of you and am now lost... |
Kalas | if it affect the first one |
jmf028 | correct |
rnjensen45 | ahead |
Kalas | we go and change a non-a |
Kalas | to a |
jmf028 | http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356387494.png |
jmf028 | so here is what it should look like Kalas |
jmf028 | and this is after i changed a C to an A |
Kalas | it does right now |
Kalas | yup got back to this point |
jmf028 | base 12 |
jmf028 | highlight this A and unhighlight the G from before if you haven't already |
rnjensen45 | k |
jmf028 | you good kalas? |
Kalas | yup |
jmf028 | ok now switch |
jmf028 | what should you do now? |
rnjensen45 | 17 to a U |
Kalas | so i need to change the g to a u? |
jmf028 | good job |
jmf028 | and what do you do with highlighting part |
Kalas | highlight u |
rnjensen45 | unhighlight A highlight U |
Kalas | switch |
jmf028 | good job |
jmf028 | and yes switch |
jmf028 | now the U is destabilizing |
rnjensen45 | :) |
Kalas | change non-a to a |
jmf028 | what do we do |
jmf028 | good job kalas |
jmf028 | now in this case, why won't changing G be good |
jmf028 | not first but bottom G |
rnjensen45 | isnt that the one we just did the time before? |
jmf028 | correct |
jmf028 | so skip that and try the last one you can |
rnjensen45 | #13 |
jmf028 | right rnj that should stay the same |
rnjensen45 | so do we change #18 from U to A |
jmf028 | correct rn |
Kalas | no |
Kalas | uhh |
jmf028 | what up kalas |
Kalas | How can i see the numbers when i want ? |
jmf028 | oh gears below |
rnjensen45 | first check box |
Kalas | so much better |
Kalas | thanks |
rnjensen45 | show nuc.. numbers |
jmf028 | np |
jmf028 | okay here is what it should look like so far |
jmf028 | http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356387860.png |
Kalas | number 18 switched |
jmf028 | now switch |
jmf028 | yep kalas |
jmf028 | do you understand why tho |
Kalas | stabilised the first one |
jmf028 | right but why 18 and not 13 |
Kalas | we added 13 no? |
jmf028 | correct |
jmf028 | now from here you can switch back |
Kalas | should we highlight it to remember not to touch it anymore? |
jmf028 | no because it gets even more confusing |
Kalas | ok |
jmf028 | trust me i tried that before |
jmf028 | it makes you think you should change it's base pair |
jmf028 | now, with this part do the same thing until you get to another loop in one of the structures |
rnjensen45 | thx, I was stuck in that recursive he** |
jmf028 | haha |
rnjensen45 | so U in 18 |
Kalas | so |
Kalas | Can i change number 17 to a? |
jmf028 | try not to yet |
jmf028 | hold on |
rnjensen45 | sorry, U in 11 |
jmf028 | all right |
jmf028 | notice nothing more works other than what we have already tried |
jmf028 | so lets undo until everything pairs and the first structure is stabilized :) |
jmf028 | this is what we call a trial and error error |
jmf028 | but we learned something from it |
rnjensen45 | ok, so effectively we try this pattern to its normal conclusion, which is eiher a solve or a dead end |
jmf028 | well sometimes rn |
jmf028 | but just looking to boost one side without effecting the other [11:36 PM] |
jmf028 | in this case it didn't work |
jmf028 | but its good to know that trick |
jmf028 | becomes useful in the bigger switches |
jmf028 | alright should look like this |
jmf028 | http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356388230.png |
rnjensen45 | yep, |
jmf028 | kalas you good? |
Kalas | yes |
jmf028 | okay now be in the same state as this last picture |
Kalas | just done it |
jmf028 | look up at the top where it shows an instability in the loop |
jmf028 | oh kalas you finished? |
Kalas | no |
jmf028 | ok |
Kalas | jim at your state |
Kalas | thats what i said |
Kalas | meant |
jmf028 | okay |
Kalas | what i meant |
Kalas | * |
jmf028 | so as i said before notice instability in the loop |
jmf028 | the open loop |
jmf028 | not the middle one |
rnjensen45 | k |
jmf028 | lets get rid of that shall we |
jmf028 | what do we start doing first |
Kalas | change g number 12 |
Kalas | to a |
Kalas | ? |
Kalas | Highlight a? |
jmf028 | correct |
jmf028 | notice how that was all you needed to do to stabilize it |
Kalas | yep |
jmf028 | now switch and do keep making changes til you get to another loop |
jmf028 | op |
jmf028 | we did it |
jmf028 | its solved |
jmf028 | anyone else solve it? |
Kalas | nope, trying |
jmf028 | well if you changed the G to an A at the bottom? |
rnjensen45 | not yet... |
jmf028 | http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356388571.png |
jmf028 | that was from the change |
jmf028 | here is what we started with |
jmf028 | http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356388601.png |
jmf028 | rn didn't you say change the G to an A |
Kalas | oh |
Kalas | it worked |
jmf028 | did you solve it? |
Kalas | yeah |
jmf028 | gj kalas |
rnjensen45 | sorry, I lost you somewhere, give me a minute |
jmf028 | rn start with this sequence |
jmf028 | http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356388675.png |
Kalas | so this is the easiest switch? |
Kalas | This is hell haha |
jmf028 | correct kalas |
rnjensen45 | :D |
jmf028 | well you get used to it |
jmf028 | did you solve it rn? |
Kalas | But with those tricks, i think i get it |
jmf028 | thats great kalas |
jmf028 | hope that helped |
Kalas | Thanks jmf! ;-) |
jmf028 | there are more tricks but they vary in difficulty and your welcome :) |
jmf028 | rn did you solve it? |
rnjensen45 | no I am lost |
rnjensen45 | http://eterna.cmu.edu/sites/default/files/chat_screens/60391_1356388815.png |
jmf028 | start from the sequence i gave you |
openatheclose | Finishing puzzles with 0/18 GC pairs. #YOLO |
jmf028 | okay now try switching |
jmf028 | rn that should actually be a solution my bad |
jmf028 | didn't mean to show solution |
jmf028 | forgot to also change back the U i added |
jmf028 | so i gave you answer XD |
jmf028 | anyway rn you understand it i think |
jmf028 | did the tutorial help at least? |
rnjensen45 | yes, I will give this out... not sure how I lost you at the end... |
rnjensen45 | the tutorial was really good. |
jmf028 | good i'm glad |
rnjensen45 | What I struggle with is I can get close, but didn't have a plan for the end game. |
jmf028 | yeah that is the fun part for me |
rnjensen45 | one struggle is when both puzzles resolve to the same shape because energy isn't right ie molecule doesn't move it |
jmf028 | right |
rnjensen45 | actually had jet plane to that point, but lost it trying to get energy balanced |
jmf028 | that's actually the reason jet plane is so hard |
jmf028 | it does that alot |
Jieux | why is jet plane so hard? |
jmf028 | joke detected |
jmf028 | answer because it is compiling |
Tesla'sDisciple | jet plane was hard? |
jmf028 | oh you guys are too much |
Jieux | I have yet to solve it. |
Jieux | and I'm not doing any switches til I do. |
jmf028 | well that is a switch |
jmf028 | and therein lies your dilemma |
Jieux | any other switches silly. |
jmf028 | :D |
Jieux | 8P |
jmf028 | did you guys have any other things you would have liked to add to that tutorial? |
Jieux | what tutorial? |
jmf028 | the tutorial i just gave for switches |
Tesla'sDisciple | you did a great job jmf |
rnjensen45 | agreed, thx again... |
Kalas | yeah thanks! |
Tesla'sDisciple | like you said, there are some other advanced tricks, but you need to get some switches under your belt first |