API for Server Data Queries/Server Queries: type=lab synthesized results

From Eterna Wiki

< API for Server Data Queries

Revision as of 21:23, 7 April 2015 by Omei (talk | contribs) (Created page with "<p>__TOC__</p> <p>==Sample query==</p> <p>http://eterna.cmu.edu//get/?type=project&nid=3376330</p> <p><span id="s-1" class="sBrace structure-1">{ <a></a> </span>...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

The printable version is no longer supported and may have rendering errors. Please update your browser bookmarks and please use the default browser print function instead.

==Sample query==

http://eterna.cmu.edu//get/?type=project&nid=3376330

{ <a></a> 
   "data":{ <a></a> 
      "lab_title":"MS2 Riboswitches On Chip - Round 2",
      "founder":"126931",
      "current_round":27,
      "synthesized_results":{ <a></a> 
         "synthesized":[ <a></a> 
            [ <a></a> 
               "Tesla'sDisciple",
               "Ex 1 Tesla 1",
               "AUAAAACAUGAGGAUCACCCAUGUGAGGAUAUGCGAAAUAAAGAAAUAAAUAAAUAAAGCAGAAGGCACAAUAA",
               "5452508",
               "3",
               0,
               "No comment",
               "1",
               "6",
               "3",
               "0",
               77,
               "-7.4",
               "Yes",
               "59",
               "0.5"
            ],
            [ <a></a> 
               "Jieux",
               "Angelica Baggins - Jieux - Exclusion 1",
               "AAAAAACAUGAGGAUCACCCAUGUCAGGAUAUACAAAAAAAAAAAAAAAAAAAAAAAAGUAGAAGGGACAAAAA",
               "5453873",
               "2",
               0,
               "6 white boxes",
               "1",
               "4",
               "3",
               "0",
               77,
               "-5.7",
               "No",
               0,
               0
            ],

            ...

         ]

      }

   }

}

 

==Notes==

 

An array is returned for each result.  The array fields, by index, are

    0: Designer

    1: Design name

    2: Sequence

    3: Design ID

    4: Votes

    5: My votes 

    6: Description

    7: Round (?)

    8: # GC pairs

    9: # AU pairs

   10: # GU pairs

   11: Melting point

   12: Free Energy

   13: Synthesized

   14: Score

   15: SHAPE Threshold