API for Server Data Queries/Server Queries: type=lab synthesized results

From EteRNA WiKi
< API for Server Data Queries
Revision as of 21:23, 7 April 2015 by Omei (Talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search

Contents

Sample query

http://eterna.cmu.edu//get/?type=project&nid=3376330

 
   "data": 
      "lab_title":"MS2 Riboswitches On Chip - Round 2",
      "founder":"126931",
      "current_round":27,
      "synthesized_results": 
         "synthesized": 
             
               "Tesla'sDisciple",
               "Ex 1 Tesla 1",
               "AUAAAACAUGAGGAUCACCCAUGUGAGGAUAUGCGAAAUAAAGAAAUAAAUAAAUAAAGCAGAAGGCACAAUAA",
               "5452508",
               "3",
               0,
               "No comment",
               "1",
               "6",
               "3",
               "0",
               77,
               "-7.4",
               "Yes",
               "59",
               "0.5"
            ],
             
               "Jieux",
               "Angelica Baggins - Jieux - Exclusion 1",
               "AAAAAACAUGAGGAUCACCCAUGUCAGGAUAUACAAAAAAAAAAAAAAAAAAAAAAAAGUAGAAGGGACAAAAA",
               "5453873",
               "2",
               0,
               "6 white boxes",
               "1",
               "4",
               "3",
               "0",
               77,
               "-5.7",
               "No",
               0,
               0
            ],

            ...

         ]

      }

   }

}

 

Notes

 

An array is returned for each result.  The array fields, by index, are

    0: Designer

    1: Design name

    2: Sequence

    3: Design ID

    4: Votes

    5: My votes 

    6: Description

    7: Round (?)

    8: # GC pairs

    9: # AU pairs

   10: # GU pairs

   11: Melting point

   12: Free Energy

   13: Synthesized

   14: Score

   15: SHAPE Threshold

Personal tools
Main page
Introduction to the Game