Difference between revisions of "API for Server Data Queries/Server Queries: type=lab"

From EteRNA WiKi
Jump to: navigation, search
(Created initial page)
(Undo revision 3109 by Omei (talk))
 
Line 3: Line 3:
 
<p>http://eterna.cmu.edu//get/?type=lab&amp;nid=2857430</p>
 
<p>http://eterna.cmu.edu//get/?type=lab&amp;nid=2857430</p>
 
<p>==Results==</p>
 
<p>==Results==</p>
<p>{<br />&nbsp;&nbsp; "data":{<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "lab":{<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "nid":"3376330",<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "created":"1380239360",<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "title":"Reproducibility Lab 1",<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "body":"The Reproducibilty Test Lab is a series of cloud labs that will be synthesized with each synthesis round. The idea is to run a controlled set of RNA designs over multiple synthesis rounds and compare the SHAPE results between identical designs over time.The objectives for this series are: * Provide a consistent measure of the reproducibility of the cloud lab synthesis results, for long term quality control, * Determine how much of the variation in synthesis results is captured by the error estimates reported for each synthesized base,The Reproducibilty Test Lab is a series of cloud labs that will be synthesized with each synthesis round. The idea is to run a controlled set of RNA designs over multiple synthesis rounds and compare the SHAPE results between identical designs over time.The objectives for this series are: * Provide a consistent measure of the reproducibility of the cloud lab synthesis results, for long term quality control, * Determine how much of the variation in synthesis results is captured by the error estimates reported for each synthesized base, * Provide some guidance as to where the synthesis process might be improved, in order to increase reproducibility, and * Give those analyzing the synthesis data a better understanding of the variation to expect when comparing data from different synthesis rounds.",<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "uid":"57675",<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "puzzles":[<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; {<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "puzzles":[<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; {<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "nid":"3293294",<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "title":"Reproducibility Lab 1",<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "secstruct":".........................................................................................",<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "sequence":null,<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "rna_type":"single",<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "object":null,<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "cover_image":"\/sites\/default\/files\/cloud_lab_pictures\/picture-1378244610.png",<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "num_slots":40,<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "constraints":"SHAPE,0,CONSECUTIVE_G,4,CONSECUTIVE_C,4,CONSECUTIVE_A,5,SOFT,0",<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "synthesized_solutions":[<br /><br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; ],<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "num_solutions":0,<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "my_votes":0,<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "submitted":40,<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "num_synthesized":40<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; }<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; ],<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "round":0<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; }<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; ],<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "winner":"1",<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "exp_phase":"1",<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "synthesis_date":null,<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "proposed_date":null,<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "affiliation":"Eterna players",<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "email":null,<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "selection":null,<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "pending":null,<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "voters":null,<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "cover_image":"https:\/\/s3.amazonaws.com\/eterna\/cloud_lab_pictures\/picture-1378244610.png",<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "synthesized_solutions":[<br /><br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; ],<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "current_cloud_round":11<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; },<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "comments":[<br /><br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; ],<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "supercomments":[<br /><br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; ],<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "follow":[<br /><br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; ],<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "sum_picks":null,<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "my_votes":0,<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "uid":"57675"<br />&nbsp;&nbsp; },<br />&nbsp;&nbsp; "memcache":true<br />}</p>
+
<p><span id="s-1" class="sBrace structure-1">{</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span id="s-2" class="sObjectK">"data"</span><span id="s-3" class="sColon">:</span><span id="s-4" class="sBrace structure-2">{</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-5" class="sObjectK">"lab"</span><span id="s-6" class="sColon">:</span><span id="s-7" class="sBrace structure-3">{</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-8" class="sObjectK">"puzzle_nid"</span><span id="s-9" class="sColon">:</span><span id="s-10" class="sObjectV">"2857430"</span><span id="s-11" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-12" class="sObjectK">"secstruct"</span><span id="s-13" class="sColon">:</span><span id="s-14" class="sObjectV">"((.(((((....))))).(((((....)).((((....)))).)))..))..(((....))).(((((((....)))))))."</span><span id="s-15" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-16" class="sObjectK">"rna_type"</span><span id="s-17" class="sColon">:</span><span id="s-18" class="sObjectV">"single"</span><span id="s-19" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-20" class="sObjectK">"object"</span><span id="s-21" class="sColon">:</span><span id="s-22" class="sObjectV">null</span><span id="s-23" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-24" class="sObjectK">"nid"</span><span id="s-25" class="sColon">:</span><span id="s-26" class="sObjectV">"2857430"</span><span id="s-27" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-28" class="sObjectK">"created"</span><span id="s-29" class="sColon">:</span><span id="s-30" class="sObjectV">"1368648880"</span><span id="s-31" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-32" class="sObjectK">"title"</span><span id="s-33" class="sColon">:</span><span id="s-34" class="sObjectV">"The&nbsp;GAAA&nbsp;loop"</span><span id="s-35" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-36" class="sObjectK">"body"</span><span id="s-37" class="sColon">:</span><span id="s-38" class="sObjectV">"The&nbsp;GAAA&nbsp;tetraloop&nbsp;is&nbsp;one&nbsp;of&nbsp;the&nbsp;most&nbsp;common&nbsp;tetraloop&nbsp;sequences&nbsp;found&nbsp;in&nbsp;nature.&nbsp;&nbsp;However,&nbsp;in&nbsp;the&nbsp;lab&nbsp;the&nbsp;SHAPE&nbsp;data&nbsp;shows&nbsp;that&nbsp;in&nbsp;a&nbsp;large&nbsp;percentage&nbsp;of&nbsp;cases,&nbsp;the&nbsp;closing&nbsp;base&nbsp;nucleotides&nbsp;are&nbsp;not&nbsp;measured&nbsp;as&nbsp;being&nbsp;tightly&nbsp;bound.&nbsp;&nbsp;Perusing&nbsp;the&nbsp;CoSSMos&nbsp;database&nbsp;(http:\/\/cossmos.slu.edu\/),&nbsp;it&nbsp;seems&nbsp;that&nbsp;the&nbsp;nucleotides&nbsp;in&nbsp;the&nbsp;loop&nbsp;can&nbsp;take&nbsp;on&nbsp;quite&nbsp;varied&nbsp;3D&nbsp;arrangements.&nbsp;&nbsp;Some&nbsp;of&nbsp;these&nbsp;have&nbsp;the&nbsp;closing&nbsp;base&nbsp;pairs&nbsp;appear&nbsp;to&nbsp;have&nbsp;strong&nbsp;Watson-Crick&nbsp;bindings,&nbsp;but&nbsp;many&nbsp;do&nbsp;not.&nbsp;&nbsp;The&nbsp;hope&nbsp;for&nbsp;this&nbsp;lab&nbsp;is&nbsp;that&nbsp;we&nbsp;can&nbsp;discover&nbsp;what&nbsp;hairpin&nbsp;base&nbsp;sequences&nbsp;score&nbsp;well&nbsp;in&nbsp;the&nbsp;lab&nbsp;when&nbsp;the&nbsp;loop&nbsp;sequence&nbsp;is&nbsp;GAAA."</span><span id="s-39" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-40" class="sObjectK">"uid"</span><span id="s-41" class="sColon">:</span><span id="s-42" class="sObjectV">"57675"</span><span id="s-43" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-44" class="sObjectK">"field_puzzle_synthesis_winner_nid"</span><span id="s-45" class="sColon">:</span><span id="s-46" class="sObjectV">"2389702"</span><span id="s-47" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-48" class="sObjectK">"exp_phase"</span><span id="s-49" class="sColon">:</span><span id="s-50" class="sObjectV">"1"</span><span id="s-51" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-52" class="sObjectK">"exp_phase_start"</span><span id="s-53" class="sColon">:</span><span id="s-54" class="sObjectV">null</span><span id="s-55" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-56" class="sObjectK">"exp_phase_end"</span><span id="s-57" class="sColon">:</span><span id="s-58" class="sObjectV">null</span><span id="s-59" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-60" class="sObjectK">"last_round"</span><span id="s-61" class="sColon">:</span><span id="s-62" class="sObjectV">"0"</span><span id="s-63" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-64" class="sObjectK">"date"</span><span id="s-65" class="sColon">:</span><span id="s-66" class="sObjectV">"05\/22\/2013&nbsp;11:59&nbsp;PM"</span><span id="s-67" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-68" class="sObjectK">"num_synth"</span><span id="s-69" class="sColon">:</span><span id="s-70" class="sObjectV">"40"</span><span id="s-71" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-72" class="sObjectK">"affiliation"</span><span id="s-73" class="sColon">:</span><span id="s-74" class="sObjectV">null</span><span id="s-75" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-76" class="sObjectK">"selection"</span><span id="s-77" class="sColon">:</span><span id="s-78" class="sObjectV">"user_vote"</span><span id="s-79" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-80" class="sObjectK">"pending"</span><span id="s-81" class="sColon">:</span><span id="s-82" class="sObjectV">null</span><span id="s-83" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-84" class="sObjectK">"voters"</span><span id="s-85" class="sColon">:</span><span id="s-86" class="sObjectV">null</span><span id="s-87" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-88" class="sObjectK">"cover_image"</span><span id="s-89" class="sColon">:</span><span id="s-90" class="sObjectV">null</span><span id="s-91" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-92" class="sObjectK">"round"</span><span id="s-93" class="sColon">:</span><span id="s-94" class="sObjectV">1</span><span id="s-95" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-96" class="sObjectK">"synthesized_solutions"</span><span id="s-97" class="sColon">:</span><span id="s-98" class="sBracket structure-4">[</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-99" class="sBrace structure-5">{</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-100" class="sObjectK">"title"</span><span id="s-101" class="sColon">:</span><span id="s-102" class="sObjectV">"GAAA&nbsp;Loop&nbsp;2z"</span><span id="s-103" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-104" class="sObjectK">"id"</span><span id="s-105" class="sColon">:</span><span id="s-106" class="sObjectV">"2872419"</span><span id="s-107" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-108" class="sObjectK">"created"</span><span id="s-109" class="sColon">:</span><span id="s-110" class="sObjectV">"1369076516"</span><span id="s-111" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-112" class="sObjectK">"body"</span><span id="s-113" class="sColon">:</span><span id="s-114" class="sObjectV">"No&nbsp;comment"</span><span id="s-115" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-116" class="sObjectK">"sequence"</span><span id="s-117" class="sColon">:</span><span id="s-118" class="sObjectV">"GGAAAGCAGAUGGGAAACCAUCAGGCCGGAAACGAGCAGGAAACUGCAGCCAAGCAAGCGGAAACGCAGAGUACCUUCGGGUACUCAAAAGAAACAACAACAACAAC"</span><span id="s-119" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-120" class="sObjectK">"puznid"</span><span id="s-121" class="sColon">:</span><span id="s-122" class="sObjectV">"2857430"</span><span id="s-123" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-124" class="sObjectK">"name"</span><span id="s-125" class="sColon">:</span><span id="s-126" class="sObjectV">"Zanna"</span><span id="s-127" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-128" class="sObjectK">"uid"</span><span id="s-129" class="sColon">:</span><span id="s-130" class="sObjectV">"87216"</span><span id="s-131" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-132" class="sObjectK">"picture"</span><span id="s-133" class="sColon">:</span><span id="s-134" class="sObjectV">"sites\/default\/files\/pictures\/picture-87216.jpg"</span><span id="s-135" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-136" class="sObjectK">"synthesis-score"</span><span id="s-137" class="sColon">:</span><span id="s-138" class="sObjectV">"93"</span><span id="s-139" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-140" class="sObjectK">"synthesis-round"</span><span id="s-141" class="sColon">:</span><span id="s-142" class="sObjectV">"1"</span><span id="s-143" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-144" class="sObjectK">"submitted-round"</span><span id="s-145" class="sColon">:</span><span id="s-146" class="sObjectV">"1"</span><span id="s-147" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-148" class="sObjectK">"gu"</span><span id="s-149" class="sColon">:</span><span id="s-150" class="sObjectV">"0"</span><span id="s-151" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-152" class="sObjectK">"gc"</span><span id="s-153" class="sColon">:</span><span id="s-154" class="sObjectV">"20"</span><span id="s-155" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-156" class="sObjectK">"au"</span><span id="s-157" class="sColon">:</span><span id="s-158" class="sObjectV">"6"</span><span id="s-159" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-160" class="sObjectK">"meltpoint"</span><span id="s-161" class="sColon">:</span><span id="s-162" class="sObjectV">"107.00"</span><span id="s-163" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-164" class="sObjectK">"energy"</span><span id="s-165" class="sColon">:</span><span id="s-166" class="sObjectV">"-51.1"</span><span id="s-167" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-168" class="sObjectK">"SHAPE"</span><span id="s-169" class="sColon">:</span><span id="s-170" class="sObjectV">"1,&nbsp;0.708,&nbsp;0.7335,&nbsp;1.1768,&nbsp;0.6047,&nbsp;0.7158,&nbsp;0.3601,&nbsp;0.3418,&nbsp;0.4304,&nbsp;0.1566,&nbsp;0.0495,&nbsp;0.0165,&nbsp;0.0989,&nbsp;0.033,&nbsp;0.1972,&nbsp;0.7872,&nbsp;0.3466,&nbsp;0.4178,&nbsp;0.0321,&nbsp;0.0161,&nbsp;0.0139,&nbsp;0.039,&nbsp;0.2145,&nbsp;0.2653,&nbsp;0.6008,&nbsp;0.3247,&nbsp;0.1176,&nbsp;0.0845,&nbsp;0.2583,&nbsp;0.9568,&nbsp;1.2771,&nbsp;1.2119,&nbsp;0.4502,&nbsp;0.2249,&nbsp;0.9119,&nbsp;1.175,&nbsp;0.1892,&nbsp;0.1214,&nbsp;0.1837,&nbsp;0.2113,&nbsp;0.5323,&nbsp;1.2314,&nbsp;0.7564,&nbsp;0.5279,&nbsp;0.1902,&nbsp;0.1093,&nbsp;0.0402,&nbsp;0.0689,&nbsp;0.2536,&nbsp;0.5254,&nbsp;0.1629,&nbsp;0.2216,&nbsp;0.6726,&nbsp;1.0855,&nbsp;0.5482,&nbsp;0.6624,&nbsp;0.9893,&nbsp;1.084,&nbsp;0.2315,&nbsp;0.0854,&nbsp;0.3391,&nbsp;0.1929,&nbsp;1.099,&nbsp;0.8844,&nbsp;0.3507,&nbsp;0.1385,&nbsp;0.0801,&nbsp;0.3576,&nbsp;0.586,&nbsp;0.1796,&nbsp;0.0631,&nbsp;0.021,&nbsp;0.0457,&nbsp;0.1595,&nbsp;0.0436,&nbsp;0.2587,&nbsp;0.5577,&nbsp;0.2353,&nbsp;0.3346,&nbsp;0,&nbsp;0"</span><span id="s-171" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-172" class="sObjectK">"SHAPE-threshold"</span><span id="s-173" class="sColon">:</span><span id="s-174" class="sObjectV">"0.388"</span><span id="s-175" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-176" class="sObjectK">"SHAPE-max"</span><span id="s-177" class="sColon">:</span><span id="s-178" class="sObjectV">"0.712"</span><span id="s-179" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-180" class="sObjectK">"SHAPE-min"</span><span id="s-181" class="sColon">:</span><span id="s-182" class="sObjectV">"0.065"</span><span id="s-183" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-184" class="sObjectK">"synthesis-data"</span><span id="s-185" class="sColon">:</span><span id="s-186" class="sObjectV">"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.065,\"max\":0.712,\"threshold\":0.388,\"peaks\":[0.708,0.7335,1.1768,0.6047,0.7158,0.3601,0.3418,0.4304,0.1566,0.0495,0.0165,0.0989,0.033,0.1972,0.7872,0.3466,0.4178,0.0321,0.0161,0.0139,0.039,0.2145,0.2653,0.6008,0.3247,0.1176,0.0845,0.2583,0.9568,1.2771,1.2119,0.4502,0.2249,0.9119,1.175,0.1892,0.1214,0.1837,0.2113,0.5323,1.2314,0.7564,0.5279,0.1902,0.1093,0.0402,0.0689,0.2536,0.5254,0.1629,0.2216,0.6726,1.0855,0.5482,0.6624,0.9893,1.084,0.2315,0.0854,0.3391,0.1929,1.099,0.8844,0.3507,0.1385,0.0801,0.3576,0.586,0.1796,0.0631,0.021,0.0457,0.1595,0.0436,0.2587,0.5577,0.2353,0.3346,0,0]}]"</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-187" class="sBrace structure-5">}</span><span id="s-188" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-189" class="sBrace structure-5">{</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-190" class="sObjectK">"title"</span><span id="s-191" class="sColon">:</span><span id="s-192" class="sObjectV">"G3AAA&nbsp;-&nbsp;Brourd&nbsp;-&nbsp;Lab&nbsp;'The&nbsp;GAAA&nbsp;loop'&nbsp;R1&nbsp;-&nbsp;Sub&nbsp;3&nbsp;(Extra&nbsp;G-C&nbsp;pairs)"</span><span id="s-193" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-194" class="sObjectK">"id"</span><span id="s-195" class="sColon">:</span><span id="s-196" class="sObjectV">"2874172"</span><span id="s-197" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-198" class="sObjectK">"created"</span><span id="s-199" class="sColon">:</span><span id="s-200" class="sObjectV">"1369119898"</span><span id="s-201" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-202" class="sObjectK">"body"</span><span id="s-203" class="sColon">:</span><span id="s-204" class="sObjectV">"No&nbsp;comment"</span><span id="s-205" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-206" class="sObjectK">"sequence"</span><span id="s-207" class="sColon">:</span><span id="s-208" class="sObjectV">"GGAAAGCAGAUGGGAAACCAUCAGGCCCGAAAGGUGAGCGAAAGCUCUGCCAAGCAAGCCGAAAGGCACUACGACUUCGGUCGUAGAAAAGAAACAACAACAACAAC"</span><span id="s-209" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-210" class="sObjectK">"puznid"</span><span id="s-211" class="sColon">:</span><span id="s-212" class="sObjectV">"2857430"</span><span id="s-213" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-214" class="sObjectK">"name"</span><span id="s-215" class="sColon">:</span><span id="s-216" class="sObjectV">"Brourd"</span><span id="s-217" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-218" class="sObjectK">"uid"</span><span id="s-219" class="sColon">:</span><span id="s-220" class="sObjectV">"24263"</span><span id="s-221" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-222" class="sObjectK">"picture"</span><span id="s-223" class="sColon">:</span><span id="s-224" class="sObjectV">"sites\/default\/files\/pictures\/picture-24263.png"</span><span id="s-225" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-226" class="sObjectK">"synthesis-score"</span><span id="s-227" class="sColon">:</span><span id="s-228" class="sObjectV">"91"</span><span id="s-229" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-230" class="sObjectK">"synthesis-round"</span><span id="s-231" class="sColon">:</span><span id="s-232" class="sObjectV">"1"</span><span id="s-233" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-234" class="sObjectK">"submitted-round"</span><span id="s-235" class="sColon">:</span><span id="s-236" class="sObjectV">"1"</span><span id="s-237" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-238" class="sObjectK">"gu"</span><span id="s-239" class="sColon">:</span><span id="s-240" class="sObjectV">"0"</span><span id="s-241" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-242" class="sObjectK">"gc"</span><span id="s-243" class="sColon">:</span><span id="s-244" class="sObjectV">"20"</span><span id="s-245" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-246" class="sObjectK">"au"</span><span id="s-247" class="sColon">:</span><span id="s-248" class="sObjectV">"6"</span><span id="s-249" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-250" class="sObjectK">"meltpoint"</span><span id="s-251" class="sColon">:</span><span id="s-252" class="sObjectV">"107.00"</span><span id="s-253" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-254" class="sObjectK">"energy"</span><span id="s-255" class="sColon">:</span><span id="s-256" class="sObjectV">"-50.1"</span><span id="s-257" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-258" class="sObjectK">"SHAPE"</span><span id="s-259" class="sColon">:</span><span id="s-260" class="sObjectV">"1,&nbsp;0.8606,&nbsp;0.4897,&nbsp;1.0637,&nbsp;1.0238,&nbsp;0.7275,&nbsp;0.1079,&nbsp;0.1077,&nbsp;0.4183,&nbsp;0.0778,&nbsp;0.0367,&nbsp;0.0621,&nbsp;0,&nbsp;0.0931,&nbsp;0.1193,&nbsp;0.4815,&nbsp;0.4428,&nbsp;0.4853,&nbsp;0.0529,&nbsp;0.0831,&nbsp;0.0298,&nbsp;0.1132,&nbsp;0.1252,&nbsp;0.1719,&nbsp;0.2563,&nbsp;0.1467,&nbsp;0.0387,&nbsp;0.0819,&nbsp;0.3647,&nbsp;0.8225,&nbsp;1.0231,&nbsp;0.7628,&nbsp;0.3535,&nbsp;0.1444,&nbsp;0.2326,&nbsp;0.0493,&nbsp;0.0563,&nbsp;-0.0559,&nbsp;0.0422,&nbsp;0.073,&nbsp;0.0267,&nbsp;0.4138,&nbsp;0.3779,&nbsp;0.197,&nbsp;0.0414,&nbsp;0.0162,&nbsp;0.0414,&nbsp;0.1239,&nbsp;0.5425,&nbsp;0.6344,&nbsp;0.0854,&nbsp;0.1185,&nbsp;0.5792,&nbsp;0.8677,&nbsp;0.4913,&nbsp;0.7236,&nbsp;0.7464,&nbsp;0.8596,&nbsp;0.164,&nbsp;0.0755,&nbsp;0.1256,&nbsp;0.2504,&nbsp;0.5955,&nbsp;0.2843,&nbsp;0.1726,&nbsp;0.0862,&nbsp;0.0984,&nbsp;0.0856,&nbsp;0.1583,&nbsp;0.0729,&nbsp;0.0728,&nbsp;0.1462,&nbsp;0.0232,&nbsp;0.1687,&nbsp;0.1091,&nbsp;0.2039,&nbsp;0.5599,&nbsp;0.1413,&nbsp;0.3197,&nbsp;0,&nbsp;0"</span><span id="s-261" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-262" class="sObjectK">"SHAPE-threshold"</span><span id="s-263" class="sColon">:</span><span id="s-264" class="sObjectV">"0.257"</span><span id="s-265" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-266" class="sObjectK">"SHAPE-max"</span><span id="s-267" class="sColon">:</span><span id="s-268" class="sObjectV">"0.47"</span><span id="s-269" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-270" class="sObjectK">"SHAPE-min"</span><span id="s-271" class="sColon">:</span><span id="s-272" class="sObjectV">"0.043"</span><span id="s-273" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-274" class="sObjectK">"synthesis-data"</span><span id="s-275" class="sColon">:</span><span id="s-276" class="sObjectV">"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.043,\"max\":0.47,\"threshold\":0.257,\"peaks\":[0.8606,0.4897,1.0637,1.0238,0.7275,0.1079,0.1077,0.4183,0.0778,0.0367,0.0621,0,0.0931,0.1193,0.4815,0.4428,0.4853,0.0529,0.0831,0.0298,0.1132,0.1252,0.1719,0.2563,0.1467,0.0387,0.0819,0.3647,0.8225,1.0231,0.7628,0.3535,0.1444,0.2326,0.0493,0.0563,-0.0559,0.0422,0.073,0.0267,0.4138,0.3779,0.197,0.0414,0.0162,0.0414,0.1239,0.5425,0.6344,0.0854,0.1185,0.5792,0.8677,0.4913,0.7236,0.7464,0.8596,0.164,0.0755,0.1256,0.2504,0.5955,0.2843,0.1726,0.0862,0.0984,0.0856,0.1583,0.0729,0.0728,0.1462,0.0232,0.1687,0.1091,0.2039,0.5599,0.1413,0.3197,0,0]}]"</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-277" class="sBrace structure-5">}</span><span id="s-278" class="sComma">,</span></p>
 +
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; ...<br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp; </span><span id="s-998" class="sBracket structure-4">]</span><span id="s-999" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1000" class="sObjectK">"submitted"</span><span id="s-1001" class="sColon">:</span><span id="s-1002" class="sObjectV">"98"</span><span id="s-1003" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1004" class="sObjectK">"voted"</span><span id="s-1005" class="sColon">:</span><span id="s-1006" class="sObjectV">"VOTED"</span><span id="s-1007" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1008" class="sObjectK">"num_voters"</span><span id="s-1009" class="sColon">:</span><span id="s-1010" class="sObjectV">18</span><span id="s-1011" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1012" class="sObjectK">"curr_time"</span><span id="s-1013" class="sColon">:</span><span id="s-1014" class="sObjectV">1381956950</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1015" class="sBrace structure-3">}</span><span id="s-1016" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1017" class="sObjectK">"comments"</span><span id="s-1018" class="sColon">:</span><span id="s-1019" class="sBracket structure-3">[</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1020" class="sBrace structure-4">{</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1021" class="sObjectK">"cid"</span><span id="s-1022" class="sColon">:</span><span id="s-1023" class="sObjectV">"29250"</span><span id="s-1024" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1025" class="sObjectK">"name"</span><span id="s-1026" class="sColon">:</span><span id="s-1027" class="sObjectV">"ElNando888"</span><span id="s-1028" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1029" class="sObjectK">"uid"</span><span id="s-1030" class="sColon">:</span><span id="s-1031" class="sObjectV">"49507"</span><span id="s-1032" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1033" class="sObjectK">"comment"</span><span id="s-1034" class="sColon">:</span><span id="s-1035" class="sObjectV">"Voted.&nbsp;Interesting&nbsp;project.&nbsp;Maybe&nbsp;in&nbsp;a&nbsp;subsequent&nbsp;experiment,&nbsp;it&nbsp;could&nbsp;be&nbsp;expanded&nbsp;to&nbsp;the&nbsp;more&nbsp;generic&nbsp;GNRA&nbsp;form.&nbsp;Which&nbsp;prompts&nbsp;me&nbsp;that&nbsp;R&nbsp;(or&nbsp;Y&nbsp;or&nbsp;M)&nbsp;constraints&nbsp;on&nbsp;individual&nbsp;bases&nbsp;do&nbsp;not&nbsp;exist&nbsp;(yet).&nbsp;I'll&nbsp;try&nbsp;to&nbsp;not&nbsp;forget&nbsp;to&nbsp;ask&nbsp;for&nbsp;it&nbsp;in&nbsp;the&nbsp;upcoming&nbsp;dev&nbsp;chat."</span><span id="s-1036" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1037" class="sObjectK">"created"</span><span id="s-1038" class="sColon">:</span><span id="s-1039" class="sObjectV">"15&nbsp;May&nbsp;2013"</span><span id="s-1040" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1041" class="sObjectK">"picture"</span><span id="s-1042" class="sColon">:</span><span id="s-1043" class="sObjectV">"sites\/default\/files\/pictures\/picture-49507.png"</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1044" class="sBrace structure-4">}</span><span id="s-1045" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1046" class="sBrace structure-4">{</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1047" class="sObjectK">"cid"</span><span id="s-1048" class="sColon">:</span><span id="s-1049" class="sObjectV">"29263"</span><span id="s-1050" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1051" class="sObjectK">"name"</span><span id="s-1052" class="sColon">:</span><span id="s-1053" class="sObjectV">"wateronthemoon"</span><span id="s-1054" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1055" class="sObjectK">"uid"</span><span id="s-1056" class="sColon">:</span><span id="s-1057" class="sObjectV">"57743"</span><span id="s-1058" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1059" class="sObjectK">"comment"</span><span id="s-1060" class="sColon">:</span><span id="s-1061" class="sObjectV">"A&nbsp;great&nbsp;fundamental&nbsp;question,&nbsp;noted&nbsp;in&nbsp;reviewing&nbsp;lab&nbsp;results.&nbsp;+1.&nbsp;(Now&nbsp;if&nbsp;i&nbsp;can&nbsp;only&nbsp;figure&nbsp;out&nbsp;the&nbsp;rules&nbsp;to&nbsp;design&nbsp;something&nbsp;too.)"</span><span id="s-1062" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1063" class="sObjectK">"created"</span><span id="s-1064" class="sColon">:</span><span id="s-1065" class="sObjectV">"16&nbsp;May&nbsp;2013"</span><span id="s-1066" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1067" class="sObjectK">"picture"</span><span id="s-1068" class="sColon">:</span><span id="s-1069" class="sObjectV">"sites\/default\/files\/pictures\/picture-57743.jpg"</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1070" class="sBrace structure-4">}</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1071" class="sBracket structure-3">]</span><span id="s-1072" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1073" class="sObjectK">"supercomments"</span><span id="s-1074" class="sColon">:</span><span id="s-1075" class="sBracket structure-3">[</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1076" class="sBrace structure-4">{</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1077" class="sObjectK">"cid"</span><span id="s-1078" class="sColon">:</span><span id="s-1079" class="sObjectV">"29247"</span><span id="s-1080" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1081" class="sObjectK">"name"</span><span id="s-1082" class="sColon">:</span><span id="s-1083" class="sObjectV">"Omei"</span><span id="s-1084" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1085" class="sObjectK">"uid"</span><span id="s-1086" class="sColon">:</span><span id="s-1087" class="sObjectV">"57675"</span><span id="s-1088" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1089" class="sObjectK">"comment"</span><span id="s-1090" class="sColon">:</span><span id="s-1091" class="sObjectV">"Seems&nbsp;like&nbsp;it&nbsp;isn't&nbsp;possible&nbsp;to&nbsp;tell&nbsp;with&nbsp;the&nbsp;current&nbsp;UI,&nbsp;but&nbsp;the&nbsp;puzzle&nbsp;submission&nbsp;has&nbsp;all&nbsp;the&nbsp;tetraloops&nbsp;locked&nbsp;into&nbsp;a&nbsp;GAAA&nbsp;sequence."</span><span id="s-1092" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1093" class="sObjectK">"created"</span><span id="s-1094" class="sColon">:</span><span id="s-1095" class="sObjectV">"15&nbsp;May&nbsp;2013"</span><span id="s-1096" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1097" class="sObjectK">"picture"</span><span id="s-1098" class="sColon">:</span><span id="s-1099" class="sObjectV">"sites\/default\/files\/pictures\/picture-57675.png"</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1100" class="sBrace structure-4">}</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1101" class="sBracket structure-3">]</span><span id="s-1102" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1103" class="sObjectK">"num_synthesized"</span><span id="s-1104" class="sColon">:</span><span id="s-1105" class="sObjectV">40</span><span id="s-1106" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1107" class="sObjectK">"follow"</span><span id="s-1108" class="sColon">:</span><span id="s-1109" class="sBracket structure-3">[</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1110" class="sBrace structure-4">{</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1111" class="sObjectK">"nid"</span><span id="s-1112" class="sColon">:</span><span id="s-1113" class="sObjectV">"2857463"</span><span id="s-1114" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1115" class="sObjectK">"uid"</span><span id="s-1116" class="sColon">:</span><span id="s-1117" class="sObjectV">"57675"</span><span id="s-1118" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1119" class="sObjectK">"id"</span><span id="s-1120" class="sColon">:</span><span id="s-1121" class="sObjectV">"2857430"</span><span id="s-1122" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1123" class="sObjectK">"updated_time"</span><span id="s-1124" class="sColon">:</span><span id="s-1125" class="sObjectV">"1368649258"</span><span id="s-1126" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1127" class="sObjectK">"expired_time"</span><span id="s-1128" class="sColon">:</span><span id="s-1129" class="sObjectV">null</span><span id="s-1130" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1131" class="sObjectK">"type"</span><span id="s-1132" class="sColon">:</span><span id="s-1133" class="sObjectV">"node"</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1134" class="sBrace structure-4">}</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1135" class="sBracket structure-3">]</span><span id="s-1136" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1137" class="sObjectK">"num_slots"</span><span id="s-1138" class="sColon">:</span><span id="s-1139" class="sObjectV">"40"</span><span id="s-1140" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1141" class="sObjectK">"sum_picks"</span><span id="s-1142" class="sColon">:</span><span id="s-1143" class="sObjectV">"40"</span><span id="s-1144" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1145" class="sObjectK">"num_solutions"</span><span id="s-1146" class="sColon">:</span><span id="s-1147" class="sObjectV">"3"</span><span id="s-1148" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1149" class="sObjectK">"my_votes"</span><span id="s-1150" class="sColon">:</span><span id="s-1151" class="sObjectV">"8"</span><span id="s-1152" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1153" class="sObjectK">"uid"</span><span id="s-1154" class="sColon">:</span><span id="s-1155" class="sObjectV">"57675"</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1156" class="sBrace structure-2">}</span><span id="s-1157" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1158" class="sObjectK">"cached"</span><span id="s-1159" class="sColon">:</span><span id="s-1160" class="sObjectV">true</span><span id="s-1161" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1162" class="sObjectK">"memcache"</span><span id="s-1163" class="sColon">:</span><span id="s-1164" class="sObjectV">true</span><br /><span id="s-1165" class="sBrace structure-1">}</span></p>
 
<p><span class="sBrace structure-1">==Notes==<br /></span></p>
 
<p><span class="sBrace structure-1">==Notes==<br /></span></p>

Latest revision as of 18:51, 24 October 2013

Contents

Sample query

http://eterna.cmu.edu//get/?type=lab&nid=2857430

Results

{
   "data":{
      "lab":{
         "puzzle_nid":"2857430",
         "secstruct":"((.(((((....))))).(((((....)).((((....)))).)))..))..(((....))).(((((((....))))))).",
         "rna_type":"single",
         "object":null,
         "nid":"2857430",
         "created":"1368648880",
         "title":"The GAAA loop",
         "body":"The GAAA tetraloop is one of the most common tetraloop sequences found in nature.  However, in the lab the SHAPE data shows that in a large percentage of cases, the closing base nucleotides are not measured as being tightly bound.  Perusing the CoSSMos database (http:\/\/cossmos.slu.edu\/), it seems that the nucleotides in the loop can take on quite varied 3D arrangements.  Some of these have the closing base pairs appear to have strong Watson-Crick bindings, but many do not.  The hope for this lab is that we can discover what hairpin base sequences score well in the lab when the loop sequence is GAAA.",
         "uid":"57675",
         "field_puzzle_synthesis_winner_nid":"2389702",
         "exp_phase":"1",
         "exp_phase_start":null,
         "exp_phase_end":null,
         "last_round":"0",
         "date":"05\/22\/2013 11:59 PM",
         "num_synth":"40",
         "affiliation":null,
         "selection":"user_vote",
         "pending":null,
         "voters":null,
         "cover_image":null,
         "round":1,
         "synthesized_solutions":[
            {
               "title":"GAAA Loop 2z",
               "id":"2872419",
               "created":"1369076516",
               "body":"No comment",
               "sequence":"GGAAAGCAGAUGGGAAACCAUCAGGCCGGAAACGAGCAGGAAACUGCAGCCAAGCAAGCGGAAACGCAGAGUACCUUCGGGUACUCAAAAGAAACAACAACAACAAC",
               "puznid":"2857430",
               "name":"Zanna",
               "uid":"87216",
               "picture":"sites\/default\/files\/pictures\/picture-87216.jpg",
               "synthesis-score":"93",
               "synthesis-round":"1",
               "submitted-round":"1",
               "gu":"0",
               "gc":"20",
               "au":"6",
               "meltpoint":"107.00",
               "energy":"-51.1",
               "SHAPE":"1, 0.708, 0.7335, 1.1768, 0.6047, 0.7158, 0.3601, 0.3418, 0.4304, 0.1566, 0.0495, 0.0165, 0.0989, 0.033, 0.1972, 0.7872, 0.3466, 0.4178, 0.0321, 0.0161, 0.0139, 0.039, 0.2145, 0.2653, 0.6008, 0.3247, 0.1176, 0.0845, 0.2583, 0.9568, 1.2771, 1.2119, 0.4502, 0.2249, 0.9119, 1.175, 0.1892, 0.1214, 0.1837, 0.2113, 0.5323, 1.2314, 0.7564, 0.5279, 0.1902, 0.1093, 0.0402, 0.0689, 0.2536, 0.5254, 0.1629, 0.2216, 0.6726, 1.0855, 0.5482, 0.6624, 0.9893, 1.084, 0.2315, 0.0854, 0.3391, 0.1929, 1.099, 0.8844, 0.3507, 0.1385, 0.0801, 0.3576, 0.586, 0.1796, 0.0631, 0.021, 0.0457, 0.1595, 0.0436, 0.2587, 0.5577, 0.2353, 0.3346, 0, 0",
               "SHAPE-threshold":"0.388",
               "SHAPE-max":"0.712",
               "SHAPE-min":"0.065",
               "synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.065,\"max\":0.712,\"threshold\":0.388,\"peaks\":[0.708,0.7335,1.1768,0.6047,0.7158,0.3601,0.3418,0.4304,0.1566,0.0495,0.0165,0.0989,0.033,0.1972,0.7872,0.3466,0.4178,0.0321,0.0161,0.0139,0.039,0.2145,0.2653,0.6008,0.3247,0.1176,0.0845,0.2583,0.9568,1.2771,1.2119,0.4502,0.2249,0.9119,1.175,0.1892,0.1214,0.1837,0.2113,0.5323,1.2314,0.7564,0.5279,0.1902,0.1093,0.0402,0.0689,0.2536,0.5254,0.1629,0.2216,0.6726,1.0855,0.5482,0.6624,0.9893,1.084,0.2315,0.0854,0.3391,0.1929,1.099,0.8844,0.3507,0.1385,0.0801,0.3576,0.586,0.1796,0.0631,0.021,0.0457,0.1595,0.0436,0.2587,0.5577,0.2353,0.3346,0,0]}]"
            },
            {
               "title":"G3AAA - Brourd - Lab 'The GAAA loop' R1 - Sub 3 (Extra G-C pairs)",
               "id":"2874172",
               "created":"1369119898",
               "body":"No comment",
               "sequence":"GGAAAGCAGAUGGGAAACCAUCAGGCCCGAAAGGUGAGCGAAAGCUCUGCCAAGCAAGCCGAAAGGCACUACGACUUCGGUCGUAGAAAAGAAACAACAACAACAAC",
               "puznid":"2857430",
               "name":"Brourd",
               "uid":"24263",
               "picture":"sites\/default\/files\/pictures\/picture-24263.png",
               "synthesis-score":"91",
               "synthesis-round":"1",
               "submitted-round":"1",
               "gu":"0",
               "gc":"20",
               "au":"6",
               "meltpoint":"107.00",
               "energy":"-50.1",
               "SHAPE":"1, 0.8606, 0.4897, 1.0637, 1.0238, 0.7275, 0.1079, 0.1077, 0.4183, 0.0778, 0.0367, 0.0621, 0, 0.0931, 0.1193, 0.4815, 0.4428, 0.4853, 0.0529, 0.0831, 0.0298, 0.1132, 0.1252, 0.1719, 0.2563, 0.1467, 0.0387, 0.0819, 0.3647, 0.8225, 1.0231, 0.7628, 0.3535, 0.1444, 0.2326, 0.0493, 0.0563, -0.0559, 0.0422, 0.073, 0.0267, 0.4138, 0.3779, 0.197, 0.0414, 0.0162, 0.0414, 0.1239, 0.5425, 0.6344, 0.0854, 0.1185, 0.5792, 0.8677, 0.4913, 0.7236, 0.7464, 0.8596, 0.164, 0.0755, 0.1256, 0.2504, 0.5955, 0.2843, 0.1726, 0.0862, 0.0984, 0.0856, 0.1583, 0.0729, 0.0728, 0.1462, 0.0232, 0.1687, 0.1091, 0.2039, 0.5599, 0.1413, 0.3197, 0, 0",
               "SHAPE-threshold":"0.257",
               "SHAPE-max":"0.47",
               "SHAPE-min":"0.043",
               "synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.043,\"max\":0.47,\"threshold\":0.257,\"peaks\":[0.8606,0.4897,1.0637,1.0238,0.7275,0.1079,0.1077,0.4183,0.0778,0.0367,0.0621,0,0.0931,0.1193,0.4815,0.4428,0.4853,0.0529,0.0831,0.0298,0.1132,0.1252,0.1719,0.2563,0.1467,0.0387,0.0819,0.3647,0.8225,1.0231,0.7628,0.3535,0.1444,0.2326,0.0493,0.0563,-0.0559,0.0422,0.073,0.0267,0.4138,0.3779,0.197,0.0414,0.0162,0.0414,0.1239,0.5425,0.6344,0.0854,0.1185,0.5792,0.8677,0.4913,0.7236,0.7464,0.8596,0.164,0.0755,0.1256,0.2504,0.5955,0.2843,0.1726,0.0862,0.0984,0.0856,0.1583,0.0729,0.0728,0.1462,0.0232,0.1687,0.1091,0.2039,0.5599,0.1413,0.3197,0,0]}]"
            },

            ...
         ],
         "submitted":"98",
         "voted":"VOTED",
         "num_voters":18,
         "curr_time":1381956950
      },
      "comments":[
         {
            "cid":"29250",
            "name":"ElNando888",
            "uid":"49507",
            "comment":"Voted. Interesting project. Maybe in a subsequent experiment, it could be expanded to the more generic GNRA form. Which prompts me that R (or Y or M) constraints on individual bases do not exist (yet). I'll try to not forget to ask for it in the upcoming dev chat.",
            "created":"15 May 2013",
            "picture":"sites\/default\/files\/pictures\/picture-49507.png"
         },
         {
            "cid":"29263",
            "name":"wateronthemoon",
            "uid":"57743",
            "comment":"A great fundamental question, noted in reviewing lab results. +1. (Now if i can only figure out the rules to design something too.)",
            "created":"16 May 2013",
            "picture":"sites\/default\/files\/pictures\/picture-57743.jpg"
         }
      ],
      "supercomments":[
         {
            "cid":"29247",
            "name":"Omei",
            "uid":"57675",
            "comment":"Seems like it isn't possible to tell with the current UI, but the puzzle submission has all the tetraloops locked into a GAAA sequence.",
            "created":"15 May 2013",
            "picture":"sites\/default\/files\/pictures\/picture-57675.png"
         }
      ],
      "num_synthesized":40,
      "follow":[
         {
            "nid":"2857463",
            "uid":"57675",
            "id":"2857430",
            "updated_time":"1368649258",
            "expired_time":null,
            "type":"node"
         }
      ],
      "num_slots":"40",
      "sum_picks":"40",
      "num_solutions":"3",
      "my_votes":"8",
      "uid":"57675"
   },
   "cached":true,
   "memcache":true
}

Notes


Personal tools
Main page
Introduction to the Game