Difference between revisions of "API for Server Data Queries/Server Queries: type=lab"

From EteRNA WiKi
Jump to: navigation, search
(Created initial page)
Line 3: Line 3:
 
<p>http://eterna.cmu.edu//get/?type=lab&amp;nid=2857430</p>
 
<p>http://eterna.cmu.edu//get/?type=lab&amp;nid=2857430</p>
 
<p>==Results==</p>
 
<p>==Results==</p>
<p><span id="s-1" class="sBrace structure-1">{</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span id="s-2" class="sObjectK">"data"</span><span id="s-3" class="sColon">:</span><span id="s-4" class="sBrace structure-2">{</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-5" class="sObjectK">"lab"</span><span id="s-6" class="sColon">:</span><span id="s-7" class="sBrace structure-3">{</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-8" class="sObjectK">"puzzle_nid"</span><span id="s-9" class="sColon">:</span><span id="s-10" class="sObjectV">"2857430"</span><span id="s-11" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-12" class="sObjectK">"secstruct"</span><span id="s-13" class="sColon">:</span><span id="s-14" class="sObjectV">"((.(((((....))))).(((((....)).((((....)))).)))..))..(((....))).(((((((....)))))))."</span><span id="s-15" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-16" class="sObjectK">"rna_type"</span><span id="s-17" class="sColon">:</span><span id="s-18" class="sObjectV">"single"</span><span id="s-19" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-20" class="sObjectK">"object"</span><span id="s-21" class="sColon">:</span><span id="s-22" class="sObjectV">null</span><span id="s-23" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-24" class="sObjectK">"nid"</span><span id="s-25" class="sColon">:</span><span id="s-26" class="sObjectV">"2857430"</span><span id="s-27" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-28" class="sObjectK">"created"</span><span id="s-29" class="sColon">:</span><span id="s-30" class="sObjectV">"1368648880"</span><span id="s-31" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-32" class="sObjectK">"title"</span><span id="s-33" class="sColon">:</span><span id="s-34" class="sObjectV">"The&nbsp;GAAA&nbsp;loop"</span><span id="s-35" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-36" class="sObjectK">"body"</span><span id="s-37" class="sColon">:</span><span id="s-38" class="sObjectV">"The&nbsp;GAAA&nbsp;tetraloop&nbsp;is&nbsp;one&nbsp;of&nbsp;the&nbsp;most&nbsp;common&nbsp;tetraloop&nbsp;sequences&nbsp;found&nbsp;in&nbsp;nature.&nbsp;&nbsp;However,&nbsp;in&nbsp;the&nbsp;lab&nbsp;the&nbsp;SHAPE&nbsp;data&nbsp;shows&nbsp;that&nbsp;in&nbsp;a&nbsp;large&nbsp;percentage&nbsp;of&nbsp;cases,&nbsp;the&nbsp;closing&nbsp;base&nbsp;nucleotides&nbsp;are&nbsp;not&nbsp;measured&nbsp;as&nbsp;being&nbsp;tightly&nbsp;bound.&nbsp;&nbsp;Perusing&nbsp;the&nbsp;CoSSMos&nbsp;database&nbsp;(http:\/\/cossmos.slu.edu\/),&nbsp;it&nbsp;seems&nbsp;that&nbsp;the&nbsp;nucleotides&nbsp;in&nbsp;the&nbsp;loop&nbsp;can&nbsp;take&nbsp;on&nbsp;quite&nbsp;varied&nbsp;3D&nbsp;arrangements.&nbsp;&nbsp;Some&nbsp;of&nbsp;these&nbsp;have&nbsp;the&nbsp;closing&nbsp;base&nbsp;pairs&nbsp;appear&nbsp;to&nbsp;have&nbsp;strong&nbsp;Watson-Crick&nbsp;bindings,&nbsp;but&nbsp;many&nbsp;do&nbsp;not.&nbsp;&nbsp;The&nbsp;hope&nbsp;for&nbsp;this&nbsp;lab&nbsp;is&nbsp;that&nbsp;we&nbsp;can&nbsp;discover&nbsp;what&nbsp;hairpin&nbsp;base&nbsp;sequences&nbsp;score&nbsp;well&nbsp;in&nbsp;the&nbsp;lab&nbsp;when&nbsp;the&nbsp;loop&nbsp;sequence&nbsp;is&nbsp;GAAA."</span><span id="s-39" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-40" class="sObjectK">"uid"</span><span id="s-41" class="sColon">:</span><span id="s-42" class="sObjectV">"57675"</span><span id="s-43" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-44" class="sObjectK">"field_puzzle_synthesis_winner_nid"</span><span id="s-45" class="sColon">:</span><span id="s-46" class="sObjectV">"2389702"</span><span id="s-47" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-48" class="sObjectK">"exp_phase"</span><span id="s-49" class="sColon">:</span><span id="s-50" class="sObjectV">"1"</span><span id="s-51" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-52" class="sObjectK">"exp_phase_start"</span><span id="s-53" class="sColon">:</span><span id="s-54" class="sObjectV">null</span><span id="s-55" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-56" class="sObjectK">"exp_phase_end"</span><span id="s-57" class="sColon">:</span><span id="s-58" class="sObjectV">null</span><span id="s-59" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-60" class="sObjectK">"last_round"</span><span id="s-61" class="sColon">:</span><span id="s-62" class="sObjectV">"0"</span><span id="s-63" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-64" class="sObjectK">"date"</span><span id="s-65" class="sColon">:</span><span id="s-66" class="sObjectV">"05\/22\/2013&nbsp;11:59&nbsp;PM"</span><span id="s-67" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-68" class="sObjectK">"num_synth"</span><span id="s-69" class="sColon">:</span><span id="s-70" class="sObjectV">"40"</span><span id="s-71" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-72" class="sObjectK">"affiliation"</span><span id="s-73" class="sColon">:</span><span id="s-74" class="sObjectV">null</span><span id="s-75" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-76" class="sObjectK">"selection"</span><span id="s-77" class="sColon">:</span><span id="s-78" class="sObjectV">"user_vote"</span><span id="s-79" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-80" class="sObjectK">"pending"</span><span id="s-81" class="sColon">:</span><span id="s-82" class="sObjectV">null</span><span id="s-83" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-84" class="sObjectK">"voters"</span><span id="s-85" class="sColon">:</span><span id="s-86" class="sObjectV">null</span><span id="s-87" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-88" class="sObjectK">"cover_image"</span><span id="s-89" class="sColon">:</span><span id="s-90" class="sObjectV">null</span><span id="s-91" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-92" class="sObjectK">"round"</span><span id="s-93" class="sColon">:</span><span id="s-94" class="sObjectV">1</span><span id="s-95" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-96" class="sObjectK">"synthesized_solutions"</span><span id="s-97" class="sColon">:</span><span id="s-98" class="sBracket structure-4">[</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-99" class="sBrace structure-5">{</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-100" class="sObjectK">"title"</span><span id="s-101" class="sColon">:</span><span id="s-102" class="sObjectV">"GAAA&nbsp;Loop&nbsp;2z"</span><span id="s-103" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-104" class="sObjectK">"id"</span><span id="s-105" class="sColon">:</span><span id="s-106" class="sObjectV">"2872419"</span><span id="s-107" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-108" class="sObjectK">"created"</span><span id="s-109" class="sColon">:</span><span id="s-110" class="sObjectV">"1369076516"</span><span id="s-111" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-112" class="sObjectK">"body"</span><span id="s-113" class="sColon">:</span><span id="s-114" class="sObjectV">"No&nbsp;comment"</span><span id="s-115" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-116" class="sObjectK">"sequence"</span><span id="s-117" class="sColon">:</span><span id="s-118" class="sObjectV">"GGAAAGCAGAUGGGAAACCAUCAGGCCGGAAACGAGCAGGAAACUGCAGCCAAGCAAGCGGAAACGCAGAGUACCUUCGGGUACUCAAAAGAAACAACAACAACAAC"</span><span id="s-119" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-120" class="sObjectK">"puznid"</span><span id="s-121" class="sColon">:</span><span id="s-122" class="sObjectV">"2857430"</span><span id="s-123" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-124" class="sObjectK">"name"</span><span id="s-125" class="sColon">:</span><span id="s-126" class="sObjectV">"Zanna"</span><span id="s-127" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-128" class="sObjectK">"uid"</span><span id="s-129" class="sColon">:</span><span id="s-130" class="sObjectV">"87216"</span><span id="s-131" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-132" class="sObjectK">"picture"</span><span id="s-133" class="sColon">:</span><span id="s-134" class="sObjectV">"sites\/default\/files\/pictures\/picture-87216.jpg"</span><span id="s-135" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-136" class="sObjectK">"synthesis-score"</span><span id="s-137" class="sColon">:</span><span id="s-138" class="sObjectV">"93"</span><span id="s-139" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-140" class="sObjectK">"synthesis-round"</span><span id="s-141" class="sColon">:</span><span id="s-142" class="sObjectV">"1"</span><span id="s-143" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-144" class="sObjectK">"submitted-round"</span><span id="s-145" class="sColon">:</span><span id="s-146" class="sObjectV">"1"</span><span id="s-147" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-148" class="sObjectK">"gu"</span><span id="s-149" class="sColon">:</span><span id="s-150" class="sObjectV">"0"</span><span id="s-151" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-152" class="sObjectK">"gc"</span><span id="s-153" class="sColon">:</span><span id="s-154" class="sObjectV">"20"</span><span id="s-155" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-156" class="sObjectK">"au"</span><span id="s-157" class="sColon">:</span><span id="s-158" class="sObjectV">"6"</span><span id="s-159" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-160" class="sObjectK">"meltpoint"</span><span id="s-161" class="sColon">:</span><span id="s-162" class="sObjectV">"107.00"</span><span id="s-163" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-164" class="sObjectK">"energy"</span><span id="s-165" class="sColon">:</span><span id="s-166" class="sObjectV">"-51.1"</span><span id="s-167" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-168" class="sObjectK">"SHAPE"</span><span id="s-169" class="sColon">:</span><span id="s-170" class="sObjectV">"1,&nbsp;0.708,&nbsp;0.7335,&nbsp;1.1768,&nbsp;0.6047,&nbsp;0.7158,&nbsp;0.3601,&nbsp;0.3418,&nbsp;0.4304,&nbsp;0.1566,&nbsp;0.0495,&nbsp;0.0165,&nbsp;0.0989,&nbsp;0.033,&nbsp;0.1972,&nbsp;0.7872,&nbsp;0.3466,&nbsp;0.4178,&nbsp;0.0321,&nbsp;0.0161,&nbsp;0.0139,&nbsp;0.039,&nbsp;0.2145,&nbsp;0.2653,&nbsp;0.6008,&nbsp;0.3247,&nbsp;0.1176,&nbsp;0.0845,&nbsp;0.2583,&nbsp;0.9568,&nbsp;1.2771,&nbsp;1.2119,&nbsp;0.4502,&nbsp;0.2249,&nbsp;0.9119,&nbsp;1.175,&nbsp;0.1892,&nbsp;0.1214,&nbsp;0.1837,&nbsp;0.2113,&nbsp;0.5323,&nbsp;1.2314,&nbsp;0.7564,&nbsp;0.5279,&nbsp;0.1902,&nbsp;0.1093,&nbsp;0.0402,&nbsp;0.0689,&nbsp;0.2536,&nbsp;0.5254,&nbsp;0.1629,&nbsp;0.2216,&nbsp;0.6726,&nbsp;1.0855,&nbsp;0.5482,&nbsp;0.6624,&nbsp;0.9893,&nbsp;1.084,&nbsp;0.2315,&nbsp;0.0854,&nbsp;0.3391,&nbsp;0.1929,&nbsp;1.099,&nbsp;0.8844,&nbsp;0.3507,&nbsp;0.1385,&nbsp;0.0801,&nbsp;0.3576,&nbsp;0.586,&nbsp;0.1796,&nbsp;0.0631,&nbsp;0.021,&nbsp;0.0457,&nbsp;0.1595,&nbsp;0.0436,&nbsp;0.2587,&nbsp;0.5577,&nbsp;0.2353,&nbsp;0.3346,&nbsp;0,&nbsp;0"</span><span id="s-171" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-172" class="sObjectK">"SHAPE-threshold"</span><span id="s-173" class="sColon">:</span><span id="s-174" class="sObjectV">"0.388"</span><span id="s-175" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-176" class="sObjectK">"SHAPE-max"</span><span id="s-177" class="sColon">:</span><span id="s-178" class="sObjectV">"0.712"</span><span id="s-179" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-180" class="sObjectK">"SHAPE-min"</span><span id="s-181" class="sColon">:</span><span id="s-182" class="sObjectV">"0.065"</span><span id="s-183" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-184" class="sObjectK">"synthesis-data"</span><span id="s-185" class="sColon">:</span><span id="s-186" class="sObjectV">"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.065,\"max\":0.712,\"threshold\":0.388,\"peaks\":[0.708,0.7335,1.1768,0.6047,0.7158,0.3601,0.3418,0.4304,0.1566,0.0495,0.0165,0.0989,0.033,0.1972,0.7872,0.3466,0.4178,0.0321,0.0161,0.0139,0.039,0.2145,0.2653,0.6008,0.3247,0.1176,0.0845,0.2583,0.9568,1.2771,1.2119,0.4502,0.2249,0.9119,1.175,0.1892,0.1214,0.1837,0.2113,0.5323,1.2314,0.7564,0.5279,0.1902,0.1093,0.0402,0.0689,0.2536,0.5254,0.1629,0.2216,0.6726,1.0855,0.5482,0.6624,0.9893,1.084,0.2315,0.0854,0.3391,0.1929,1.099,0.8844,0.3507,0.1385,0.0801,0.3576,0.586,0.1796,0.0631,0.021,0.0457,0.1595,0.0436,0.2587,0.5577,0.2353,0.3346,0,0]}]"</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-187" class="sBrace structure-5">}</span><span id="s-188" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-189" class="sBrace structure-5">{</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-190" class="sObjectK">"title"</span><span id="s-191" class="sColon">:</span><span id="s-192" class="sObjectV">"G3AAA&nbsp;-&nbsp;Brourd&nbsp;-&nbsp;Lab&nbsp;'The&nbsp;GAAA&nbsp;loop'&nbsp;R1&nbsp;-&nbsp;Sub&nbsp;3&nbsp;(Extra&nbsp;G-C&nbsp;pairs)"</span><span id="s-193" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-194" class="sObjectK">"id"</span><span id="s-195" class="sColon">:</span><span id="s-196" class="sObjectV">"2874172"</span><span id="s-197" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-198" class="sObjectK">"created"</span><span id="s-199" class="sColon">:</span><span id="s-200" class="sObjectV">"1369119898"</span><span id="s-201" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-202" class="sObjectK">"body"</span><span id="s-203" class="sColon">:</span><span id="s-204" class="sObjectV">"No&nbsp;comment"</span><span id="s-205" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-206" class="sObjectK">"sequence"</span><span id="s-207" class="sColon">:</span><span id="s-208" class="sObjectV">"GGAAAGCAGAUGGGAAACCAUCAGGCCCGAAAGGUGAGCGAAAGCUCUGCCAAGCAAGCCGAAAGGCACUACGACUUCGGUCGUAGAAAAGAAACAACAACAACAAC"</span><span id="s-209" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-210" class="sObjectK">"puznid"</span><span id="s-211" class="sColon">:</span><span id="s-212" class="sObjectV">"2857430"</span><span id="s-213" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-214" class="sObjectK">"name"</span><span id="s-215" class="sColon">:</span><span id="s-216" class="sObjectV">"Brourd"</span><span id="s-217" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-218" class="sObjectK">"uid"</span><span id="s-219" class="sColon">:</span><span id="s-220" class="sObjectV">"24263"</span><span id="s-221" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-222" class="sObjectK">"picture"</span><span id="s-223" class="sColon">:</span><span id="s-224" class="sObjectV">"sites\/default\/files\/pictures\/picture-24263.png"</span><span id="s-225" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-226" class="sObjectK">"synthesis-score"</span><span id="s-227" class="sColon">:</span><span id="s-228" class="sObjectV">"91"</span><span id="s-229" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-230" class="sObjectK">"synthesis-round"</span><span id="s-231" class="sColon">:</span><span id="s-232" class="sObjectV">"1"</span><span id="s-233" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-234" class="sObjectK">"submitted-round"</span><span id="s-235" class="sColon">:</span><span id="s-236" class="sObjectV">"1"</span><span id="s-237" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-238" class="sObjectK">"gu"</span><span id="s-239" class="sColon">:</span><span id="s-240" class="sObjectV">"0"</span><span id="s-241" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-242" class="sObjectK">"gc"</span><span id="s-243" class="sColon">:</span><span id="s-244" class="sObjectV">"20"</span><span id="s-245" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-246" class="sObjectK">"au"</span><span id="s-247" class="sColon">:</span><span id="s-248" class="sObjectV">"6"</span><span id="s-249" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-250" class="sObjectK">"meltpoint"</span><span id="s-251" class="sColon">:</span><span id="s-252" class="sObjectV">"107.00"</span><span id="s-253" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-254" class="sObjectK">"energy"</span><span id="s-255" class="sColon">:</span><span id="s-256" class="sObjectV">"-50.1"</span><span id="s-257" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-258" class="sObjectK">"SHAPE"</span><span id="s-259" class="sColon">:</span><span id="s-260" class="sObjectV">"1,&nbsp;0.8606,&nbsp;0.4897,&nbsp;1.0637,&nbsp;1.0238,&nbsp;0.7275,&nbsp;0.1079,&nbsp;0.1077,&nbsp;0.4183,&nbsp;0.0778,&nbsp;0.0367,&nbsp;0.0621,&nbsp;0,&nbsp;0.0931,&nbsp;0.1193,&nbsp;0.4815,&nbsp;0.4428,&nbsp;0.4853,&nbsp;0.0529,&nbsp;0.0831,&nbsp;0.0298,&nbsp;0.1132,&nbsp;0.1252,&nbsp;0.1719,&nbsp;0.2563,&nbsp;0.1467,&nbsp;0.0387,&nbsp;0.0819,&nbsp;0.3647,&nbsp;0.8225,&nbsp;1.0231,&nbsp;0.7628,&nbsp;0.3535,&nbsp;0.1444,&nbsp;0.2326,&nbsp;0.0493,&nbsp;0.0563,&nbsp;-0.0559,&nbsp;0.0422,&nbsp;0.073,&nbsp;0.0267,&nbsp;0.4138,&nbsp;0.3779,&nbsp;0.197,&nbsp;0.0414,&nbsp;0.0162,&nbsp;0.0414,&nbsp;0.1239,&nbsp;0.5425,&nbsp;0.6344,&nbsp;0.0854,&nbsp;0.1185,&nbsp;0.5792,&nbsp;0.8677,&nbsp;0.4913,&nbsp;0.7236,&nbsp;0.7464,&nbsp;0.8596,&nbsp;0.164,&nbsp;0.0755,&nbsp;0.1256,&nbsp;0.2504,&nbsp;0.5955,&nbsp;0.2843,&nbsp;0.1726,&nbsp;0.0862,&nbsp;0.0984,&nbsp;0.0856,&nbsp;0.1583,&nbsp;0.0729,&nbsp;0.0728,&nbsp;0.1462,&nbsp;0.0232,&nbsp;0.1687,&nbsp;0.1091,&nbsp;0.2039,&nbsp;0.5599,&nbsp;0.1413,&nbsp;0.3197,&nbsp;0,&nbsp;0"</span><span id="s-261" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-262" class="sObjectK">"SHAPE-threshold"</span><span id="s-263" class="sColon">:</span><span id="s-264" class="sObjectV">"0.257"</span><span id="s-265" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-266" class="sObjectK">"SHAPE-max"</span><span id="s-267" class="sColon">:</span><span id="s-268" class="sObjectV">"0.47"</span><span id="s-269" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-270" class="sObjectK">"SHAPE-min"</span><span id="s-271" class="sColon">:</span><span id="s-272" class="sObjectV">"0.043"</span><span id="s-273" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-274" class="sObjectK">"synthesis-data"</span><span id="s-275" class="sColon">:</span><span id="s-276" class="sObjectV">"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.043,\"max\":0.47,\"threshold\":0.257,\"peaks\":[0.8606,0.4897,1.0637,1.0238,0.7275,0.1079,0.1077,0.4183,0.0778,0.0367,0.0621,0,0.0931,0.1193,0.4815,0.4428,0.4853,0.0529,0.0831,0.0298,0.1132,0.1252,0.1719,0.2563,0.1467,0.0387,0.0819,0.3647,0.8225,1.0231,0.7628,0.3535,0.1444,0.2326,0.0493,0.0563,-0.0559,0.0422,0.073,0.0267,0.4138,0.3779,0.197,0.0414,0.0162,0.0414,0.1239,0.5425,0.6344,0.0854,0.1185,0.5792,0.8677,0.4913,0.7236,0.7464,0.8596,0.164,0.0755,0.1256,0.2504,0.5955,0.2843,0.1726,0.0862,0.0984,0.0856,0.1583,0.0729,0.0728,0.1462,0.0232,0.1687,0.1091,0.2039,0.5599,0.1413,0.3197,0,0]}]"</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-277" class="sBrace structure-5">}</span><span id="s-278" class="sComma">,</span></p>
+
<p>{<br />&nbsp;&nbsp; "data":{<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "lab":{<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "nid":"3376330",<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "created":"1380239360",<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "title":"Reproducibility Lab 1",<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "body":"The Reproducibilty Test Lab is a series of cloud labs that will be synthesized with each synthesis round. The idea is to run a controlled set of RNA designs over multiple synthesis rounds and compare the SHAPE results between identical designs over time.The objectives for this series are: * Provide a consistent measure of the reproducibility of the cloud lab synthesis results, for long term quality control, * Determine how much of the variation in synthesis results is captured by the error estimates reported for each synthesized base,The Reproducibilty Test Lab is a series of cloud labs that will be synthesized with each synthesis round. The idea is to run a controlled set of RNA designs over multiple synthesis rounds and compare the SHAPE results between identical designs over time.The objectives for this series are: * Provide a consistent measure of the reproducibility of the cloud lab synthesis results, for long term quality control, * Determine how much of the variation in synthesis results is captured by the error estimates reported for each synthesized base, * Provide some guidance as to where the synthesis process might be improved, in order to increase reproducibility, and * Give those analyzing the synthesis data a better understanding of the variation to expect when comparing data from different synthesis rounds.",<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "uid":"57675",<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "puzzles":[<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; {<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "puzzles":[<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; {<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "nid":"3293294",<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "title":"Reproducibility Lab 1",<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "secstruct":".........................................................................................",<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "sequence":null,<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "rna_type":"single",<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "object":null,<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "cover_image":"\/sites\/default\/files\/cloud_lab_pictures\/picture-1378244610.png",<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "num_slots":40,<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "constraints":"SHAPE,0,CONSECUTIVE_G,4,CONSECUTIVE_C,4,CONSECUTIVE_A,5,SOFT,0",<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "synthesized_solutions":[<br /><br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; ],<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "num_solutions":0,<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "my_votes":0,<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "submitted":40,<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "num_synthesized":40<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; }<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; ],<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "round":0<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; }<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; ],<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "winner":"1",<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "exp_phase":"1",<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "synthesis_date":null,<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "proposed_date":null,<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "affiliation":"Eterna players",<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "email":null,<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "selection":null,<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "pending":null,<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "voters":null,<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "cover_image":"https:\/\/s3.amazonaws.com\/eterna\/cloud_lab_pictures\/picture-1378244610.png",<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "synthesized_solutions":[<br /><br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; ],<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "current_cloud_round":11<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; },<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "comments":[<br /><br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; ],<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "supercomments":[<br /><br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; ],<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "follow":[<br /><br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; ],<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "sum_picks":null,<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "my_votes":0,<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; "uid":"57675"<br />&nbsp;&nbsp; },<br />&nbsp;&nbsp; "memcache":true<br />}</p>
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; ...<br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp; </span><span id="s-998" class="sBracket structure-4">]</span><span id="s-999" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1000" class="sObjectK">"submitted"</span><span id="s-1001" class="sColon">:</span><span id="s-1002" class="sObjectV">"98"</span><span id="s-1003" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1004" class="sObjectK">"voted"</span><span id="s-1005" class="sColon">:</span><span id="s-1006" class="sObjectV">"VOTED"</span><span id="s-1007" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1008" class="sObjectK">"num_voters"</span><span id="s-1009" class="sColon">:</span><span id="s-1010" class="sObjectV">18</span><span id="s-1011" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1012" class="sObjectK">"curr_time"</span><span id="s-1013" class="sColon">:</span><span id="s-1014" class="sObjectV">1381956950</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1015" class="sBrace structure-3">}</span><span id="s-1016" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1017" class="sObjectK">"comments"</span><span id="s-1018" class="sColon">:</span><span id="s-1019" class="sBracket structure-3">[</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1020" class="sBrace structure-4">{</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1021" class="sObjectK">"cid"</span><span id="s-1022" class="sColon">:</span><span id="s-1023" class="sObjectV">"29250"</span><span id="s-1024" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1025" class="sObjectK">"name"</span><span id="s-1026" class="sColon">:</span><span id="s-1027" class="sObjectV">"ElNando888"</span><span id="s-1028" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1029" class="sObjectK">"uid"</span><span id="s-1030" class="sColon">:</span><span id="s-1031" class="sObjectV">"49507"</span><span id="s-1032" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1033" class="sObjectK">"comment"</span><span id="s-1034" class="sColon">:</span><span id="s-1035" class="sObjectV">"Voted.&nbsp;Interesting&nbsp;project.&nbsp;Maybe&nbsp;in&nbsp;a&nbsp;subsequent&nbsp;experiment,&nbsp;it&nbsp;could&nbsp;be&nbsp;expanded&nbsp;to&nbsp;the&nbsp;more&nbsp;generic&nbsp;GNRA&nbsp;form.&nbsp;Which&nbsp;prompts&nbsp;me&nbsp;that&nbsp;R&nbsp;(or&nbsp;Y&nbsp;or&nbsp;M)&nbsp;constraints&nbsp;on&nbsp;individual&nbsp;bases&nbsp;do&nbsp;not&nbsp;exist&nbsp;(yet).&nbsp;I'll&nbsp;try&nbsp;to&nbsp;not&nbsp;forget&nbsp;to&nbsp;ask&nbsp;for&nbsp;it&nbsp;in&nbsp;the&nbsp;upcoming&nbsp;dev&nbsp;chat."</span><span id="s-1036" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1037" class="sObjectK">"created"</span><span id="s-1038" class="sColon">:</span><span id="s-1039" class="sObjectV">"15&nbsp;May&nbsp;2013"</span><span id="s-1040" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1041" class="sObjectK">"picture"</span><span id="s-1042" class="sColon">:</span><span id="s-1043" class="sObjectV">"sites\/default\/files\/pictures\/picture-49507.png"</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1044" class="sBrace structure-4">}</span><span id="s-1045" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1046" class="sBrace structure-4">{</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1047" class="sObjectK">"cid"</span><span id="s-1048" class="sColon">:</span><span id="s-1049" class="sObjectV">"29263"</span><span id="s-1050" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1051" class="sObjectK">"name"</span><span id="s-1052" class="sColon">:</span><span id="s-1053" class="sObjectV">"wateronthemoon"</span><span id="s-1054" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1055" class="sObjectK">"uid"</span><span id="s-1056" class="sColon">:</span><span id="s-1057" class="sObjectV">"57743"</span><span id="s-1058" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1059" class="sObjectK">"comment"</span><span id="s-1060" class="sColon">:</span><span id="s-1061" class="sObjectV">"A&nbsp;great&nbsp;fundamental&nbsp;question,&nbsp;noted&nbsp;in&nbsp;reviewing&nbsp;lab&nbsp;results.&nbsp;+1.&nbsp;(Now&nbsp;if&nbsp;i&nbsp;can&nbsp;only&nbsp;figure&nbsp;out&nbsp;the&nbsp;rules&nbsp;to&nbsp;design&nbsp;something&nbsp;too.)"</span><span id="s-1062" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1063" class="sObjectK">"created"</span><span id="s-1064" class="sColon">:</span><span id="s-1065" class="sObjectV">"16&nbsp;May&nbsp;2013"</span><span id="s-1066" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1067" class="sObjectK">"picture"</span><span id="s-1068" class="sColon">:</span><span id="s-1069" class="sObjectV">"sites\/default\/files\/pictures\/picture-57743.jpg"</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1070" class="sBrace structure-4">}</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1071" class="sBracket structure-3">]</span><span id="s-1072" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1073" class="sObjectK">"supercomments"</span><span id="s-1074" class="sColon">:</span><span id="s-1075" class="sBracket structure-3">[</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1076" class="sBrace structure-4">{</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1077" class="sObjectK">"cid"</span><span id="s-1078" class="sColon">:</span><span id="s-1079" class="sObjectV">"29247"</span><span id="s-1080" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1081" class="sObjectK">"name"</span><span id="s-1082" class="sColon">:</span><span id="s-1083" class="sObjectV">"Omei"</span><span id="s-1084" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1085" class="sObjectK">"uid"</span><span id="s-1086" class="sColon">:</span><span id="s-1087" class="sObjectV">"57675"</span><span id="s-1088" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1089" class="sObjectK">"comment"</span><span id="s-1090" class="sColon">:</span><span id="s-1091" class="sObjectV">"Seems&nbsp;like&nbsp;it&nbsp;isn't&nbsp;possible&nbsp;to&nbsp;tell&nbsp;with&nbsp;the&nbsp;current&nbsp;UI,&nbsp;but&nbsp;the&nbsp;puzzle&nbsp;submission&nbsp;has&nbsp;all&nbsp;the&nbsp;tetraloops&nbsp;locked&nbsp;into&nbsp;a&nbsp;GAAA&nbsp;sequence."</span><span id="s-1092" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1093" class="sObjectK">"created"</span><span id="s-1094" class="sColon">:</span><span id="s-1095" class="sObjectV">"15&nbsp;May&nbsp;2013"</span><span id="s-1096" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1097" class="sObjectK">"picture"</span><span id="s-1098" class="sColon">:</span><span id="s-1099" class="sObjectV">"sites\/default\/files\/pictures\/picture-57675.png"</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1100" class="sBrace structure-4">}</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1101" class="sBracket structure-3">]</span><span id="s-1102" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1103" class="sObjectK">"num_synthesized"</span><span id="s-1104" class="sColon">:</span><span id="s-1105" class="sObjectV">40</span><span id="s-1106" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1107" class="sObjectK">"follow"</span><span id="s-1108" class="sColon">:</span><span id="s-1109" class="sBracket structure-3">[</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1110" class="sBrace structure-4">{</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1111" class="sObjectK">"nid"</span><span id="s-1112" class="sColon">:</span><span id="s-1113" class="sObjectV">"2857463"</span><span id="s-1114" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1115" class="sObjectK">"uid"</span><span id="s-1116" class="sColon">:</span><span id="s-1117" class="sObjectV">"57675"</span><span id="s-1118" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1119" class="sObjectK">"id"</span><span id="s-1120" class="sColon">:</span><span id="s-1121" class="sObjectV">"2857430"</span><span id="s-1122" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1123" class="sObjectK">"updated_time"</span><span id="s-1124" class="sColon">:</span><span id="s-1125" class="sObjectV">"1368649258"</span><span id="s-1126" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1127" class="sObjectK">"expired_time"</span><span id="s-1128" class="sColon">:</span><span id="s-1129" class="sObjectV">null</span><span id="s-1130" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1131" class="sObjectK">"type"</span><span id="s-1132" class="sColon">:</span><span id="s-1133" class="sObjectV">"node"</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1134" class="sBrace structure-4">}</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1135" class="sBracket structure-3">]</span><span id="s-1136" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1137" class="sObjectK">"num_slots"</span><span id="s-1138" class="sColon">:</span><span id="s-1139" class="sObjectV">"40"</span><span id="s-1140" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1141" class="sObjectK">"sum_picks"</span><span id="s-1142" class="sColon">:</span><span id="s-1143" class="sObjectV">"40"</span><span id="s-1144" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1145" class="sObjectK">"num_solutions"</span><span id="s-1146" class="sColon">:</span><span id="s-1147" class="sObjectV">"3"</span><span id="s-1148" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1149" class="sObjectK">"my_votes"</span><span id="s-1150" class="sColon">:</span><span id="s-1151" class="sObjectV">"8"</span><span id="s-1152" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1153" class="sObjectK">"uid"</span><span id="s-1154" class="sColon">:</span><span id="s-1155" class="sObjectV">"57675"</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1156" class="sBrace structure-2">}</span><span id="s-1157" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1158" class="sObjectK">"cached"</span><span id="s-1159" class="sColon">:</span><span id="s-1160" class="sObjectV">true</span><span id="s-1161" class="sComma">,</span><br /><span>&nbsp;&nbsp;&nbsp;</span><span id="s-1162" class="sObjectK">"memcache"</span><span id="s-1163" class="sColon">:</span><span id="s-1164" class="sObjectV">true</span><br /><span id="s-1165" class="sBrace structure-1">}</span></p>
+
 
<p><span class="sBrace structure-1">==Notes==<br /></span></p>
 
<p><span class="sBrace structure-1">==Notes==<br /></span></p>

Revision as of 18:16, 24 October 2013

Contents

Sample query

http://eterna.cmu.edu//get/?type=lab&nid=2857430

Results

{
   "data":{
      "lab":{
         "nid":"3376330",
         "created":"1380239360",
         "title":"Reproducibility Lab 1",
         "body":"The Reproducibilty Test Lab is a series of cloud labs that will be synthesized with each synthesis round. The idea is to run a controlled set of RNA designs over multiple synthesis rounds and compare the SHAPE results between identical designs over time.The objectives for this series are: * Provide a consistent measure of the reproducibility of the cloud lab synthesis results, for long term quality control, * Determine how much of the variation in synthesis results is captured by the error estimates reported for each synthesized base,The Reproducibilty Test Lab is a series of cloud labs that will be synthesized with each synthesis round. The idea is to run a controlled set of RNA designs over multiple synthesis rounds and compare the SHAPE results between identical designs over time.The objectives for this series are: * Provide a consistent measure of the reproducibility of the cloud lab synthesis results, for long term quality control, * Determine how much of the variation in synthesis results is captured by the error estimates reported for each synthesized base, * Provide some guidance as to where the synthesis process might be improved, in order to increase reproducibility, and * Give those analyzing the synthesis data a better understanding of the variation to expect when comparing data from different synthesis rounds.",
         "uid":"57675",
         "puzzles":[
            {
               "puzzles":[
                  {
                     "nid":"3293294",
                     "title":"Reproducibility Lab 1",
                     "secstruct":".........................................................................................",
                     "sequence":null,
                     "rna_type":"single",
                     "object":null,
                     "cover_image":"\/sites\/default\/files\/cloud_lab_pictures\/picture-1378244610.png",
                     "num_slots":40,
                     "constraints":"SHAPE,0,CONSECUTIVE_G,4,CONSECUTIVE_C,4,CONSECUTIVE_A,5,SOFT,0",
                     "synthesized_solutions":[

                     ],
                     "num_solutions":0,
                     "my_votes":0,
                     "submitted":40,
                     "num_synthesized":40
                  }
               ],
               "round":0
            }
         ],
         "winner":"1",
         "exp_phase":"1",
         "synthesis_date":null,
         "proposed_date":null,
         "affiliation":"Eterna players",
         "email":null,
         "selection":null,
         "pending":null,
         "voters":null,
         "cover_image":"https:\/\/s3.amazonaws.com\/eterna\/cloud_lab_pictures\/picture-1378244610.png",
         "synthesized_solutions":[

         ],
         "current_cloud_round":11
      },
      "comments":[

      ],
      "supercomments":[

      ],
      "follow":[

      ],
      "sum_picks":null,
      "my_votes":0,
      "uid":"57675"
   },
   "memcache":true
}

Notes


Personal tools
Main page
Introduction to the Game