API for Server Data Queries/Server Queries: type=lab: Difference between revisions
(Proposed format for documenting query details. Used http://jsonformatter.curiousconcept.com for formatting the response) |
ElNando888 (talk | contribs) m (ElNando888 moved page Server Queries: type=lab to API for Server Data Queries/Server Queries: type=lab: regrouping) |
(No difference)
|
Revision as of 23:00, 23 October 2013
==Sample query==
http://eterna.cmu.edu//get/?type=lab&nid=2857430
==Results==
{
"data":{
"lab":{
"puzzle_nid":"2857430",
"secstruct":"((.(((((....))))).(((((....)).((((....)))).)))..))..(((....))).(((((((....))))))).",
"rna_type":"single",
"object":null,
"nid":"2857430",
"created":"1368648880",
"title":"The GAAA loop",
"body":"The GAAA tetraloop is one of the most common tetraloop sequences found in nature. However, in the lab the SHAPE data shows that in a large percentage of cases, the closing base nucleotides are not measured as being tightly bound. Perusing the CoSSMos database (http:\/\/cossmos.slu.edu\/), it seems that the nucleotides in the loop can take on quite varied 3D arrangements. Some of these have the closing base pairs appear to have strong Watson-Crick bindings, but many do not. The hope for this lab is that we can discover what hairpin base sequences score well in the lab when the loop sequence is GAAA.",
"uid":"57675",
"field_puzzle_synthesis_winner_nid":"2389702",
"exp_phase":"1",
"exp_phase_start":null,
"exp_phase_end":null,
"last_round":"0",
"date":"05\/22\/2013 11:59 PM",
"num_synth":"40",
"affiliation":null,
"selection":"user_vote",
"pending":null,
"voters":null,
"cover_image":null,
"round":1,
"synthesized_solutions":[
{
"title":"GAAA Loop 2z",
"id":"2872419",
"created":"1369076516",
"body":"No comment",
"sequence":"GGAAAGCAGAUGGGAAACCAUCAGGCCGGAAACGAGCAGGAAACUGCAGCCAAGCAAGCGGAAACGCAGAGUACCUUCGGGUACUCAAAAGAAACAACAACAACAAC",
"puznid":"2857430",
"name":"Zanna",
"uid":"87216",
"picture":"sites\/default\/files\/pictures\/picture-87216.jpg",
"synthesis-score":"93",
"synthesis-round":"1",
"submitted-round":"1",
"gu":"0",
"gc":"20",
"au":"6",
"meltpoint":"107.00",
"energy":"-51.1",
"SHAPE":"1, 0.708, 0.7335, 1.1768, 0.6047, 0.7158, 0.3601, 0.3418, 0.4304, 0.1566, 0.0495, 0.0165, 0.0989, 0.033, 0.1972, 0.7872, 0.3466, 0.4178, 0.0321, 0.0161, 0.0139, 0.039, 0.2145, 0.2653, 0.6008, 0.3247, 0.1176, 0.0845, 0.2583, 0.9568, 1.2771, 1.2119, 0.4502, 0.2249, 0.9119, 1.175, 0.1892, 0.1214, 0.1837, 0.2113, 0.5323, 1.2314, 0.7564, 0.5279, 0.1902, 0.1093, 0.0402, 0.0689, 0.2536, 0.5254, 0.1629, 0.2216, 0.6726, 1.0855, 0.5482, 0.6624, 0.9893, 1.084, 0.2315, 0.0854, 0.3391, 0.1929, 1.099, 0.8844, 0.3507, 0.1385, 0.0801, 0.3576, 0.586, 0.1796, 0.0631, 0.021, 0.0457, 0.1595, 0.0436, 0.2587, 0.5577, 0.2353, 0.3346, 0, 0",
"SHAPE-threshold":"0.388",
"SHAPE-max":"0.712",
"SHAPE-min":"0.065",
"synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.065,\"max\":0.712,\"threshold\":0.388,\"peaks\":[0.708,0.7335,1.1768,0.6047,0.7158,0.3601,0.3418,0.4304,0.1566,0.0495,0.0165,0.0989,0.033,0.1972,0.7872,0.3466,0.4178,0.0321,0.0161,0.0139,0.039,0.2145,0.2653,0.6008,0.3247,0.1176,0.0845,0.2583,0.9568,1.2771,1.2119,0.4502,0.2249,0.9119,1.175,0.1892,0.1214,0.1837,0.2113,0.5323,1.2314,0.7564,0.5279,0.1902,0.1093,0.0402,0.0689,0.2536,0.5254,0.1629,0.2216,0.6726,1.0855,0.5482,0.6624,0.9893,1.084,0.2315,0.0854,0.3391,0.1929,1.099,0.8844,0.3507,0.1385,0.0801,0.3576,0.586,0.1796,0.0631,0.021,0.0457,0.1595,0.0436,0.2587,0.5577,0.2353,0.3346,0,0]}]"
},
{
"title":"G3AAA - Brourd - Lab 'The GAAA loop' R1 - Sub 3 (Extra G-C pairs)",
"id":"2874172",
"created":"1369119898",
"body":"No comment",
"sequence":"GGAAAGCAGAUGGGAAACCAUCAGGCCCGAAAGGUGAGCGAAAGCUCUGCCAAGCAAGCCGAAAGGCACUACGACUUCGGUCGUAGAAAAGAAACAACAACAACAAC",
"puznid":"2857430",
"name":"Brourd",
"uid":"24263",
"picture":"sites\/default\/files\/pictures\/picture-24263.png",
"synthesis-score":"91",
"synthesis-round":"1",
"submitted-round":"1",
"gu":"0",
"gc":"20",
"au":"6",
"meltpoint":"107.00",
"energy":"-50.1",
"SHAPE":"1, 0.8606, 0.4897, 1.0637, 1.0238, 0.7275, 0.1079, 0.1077, 0.4183, 0.0778, 0.0367, 0.0621, 0, 0.0931, 0.1193, 0.4815, 0.4428, 0.4853, 0.0529, 0.0831, 0.0298, 0.1132, 0.1252, 0.1719, 0.2563, 0.1467, 0.0387, 0.0819, 0.3647, 0.8225, 1.0231, 0.7628, 0.3535, 0.1444, 0.2326, 0.0493, 0.0563, -0.0559, 0.0422, 0.073, 0.0267, 0.4138, 0.3779, 0.197, 0.0414, 0.0162, 0.0414, 0.1239, 0.5425, 0.6344, 0.0854, 0.1185, 0.5792, 0.8677, 0.4913, 0.7236, 0.7464, 0.8596, 0.164, 0.0755, 0.1256, 0.2504, 0.5955, 0.2843, 0.1726, 0.0862, 0.0984, 0.0856, 0.1583, 0.0729, 0.0728, 0.1462, 0.0232, 0.1687, 0.1091, 0.2039, 0.5599, 0.1413, 0.3197, 0, 0",
"SHAPE-threshold":"0.257",
"SHAPE-max":"0.47",
"SHAPE-min":"0.043",
"synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.043,\"max\":0.47,\"threshold\":0.257,\"peaks\":[0.8606,0.4897,1.0637,1.0238,0.7275,0.1079,0.1077,0.4183,0.0778,0.0367,0.0621,0,0.0931,0.1193,0.4815,0.4428,0.4853,0.0529,0.0831,0.0298,0.1132,0.1252,0.1719,0.2563,0.1467,0.0387,0.0819,0.3647,0.8225,1.0231,0.7628,0.3535,0.1444,0.2326,0.0493,0.0563,-0.0559,0.0422,0.073,0.0267,0.4138,0.3779,0.197,0.0414,0.0162,0.0414,0.1239,0.5425,0.6344,0.0854,0.1185,0.5792,0.8677,0.4913,0.7236,0.7464,0.8596,0.164,0.0755,0.1256,0.2504,0.5955,0.2843,0.1726,0.0862,0.0984,0.0856,0.1583,0.0729,0.0728,0.1462,0.0232,0.1687,0.1091,0.2039,0.5599,0.1413,0.3197,0,0]}]"
},
...
],
"submitted":"98",
"voted":"VOTED",
"num_voters":18,
"curr_time":1381956950
},
"comments":[
{
"cid":"29250",
"name":"ElNando888",
"uid":"49507",
"comment":"Voted. Interesting project. Maybe in a subsequent experiment, it could be expanded to the more generic GNRA form. Which prompts me that R (or Y or M) constraints on individual bases do not exist (yet). I'll try to not forget to ask for it in the upcoming dev chat.",
"created":"15 May 2013",
"picture":"sites\/default\/files\/pictures\/picture-49507.png"
},
{
"cid":"29263",
"name":"wateronthemoon",
"uid":"57743",
"comment":"A great fundamental question, noted in reviewing lab results. +1. (Now if i can only figure out the rules to design something too.)",
"created":"16 May 2013",
"picture":"sites\/default\/files\/pictures\/picture-57743.jpg"
}
],
"supercomments":[
{
"cid":"29247",
"name":"Omei",
"uid":"57675",
"comment":"Seems like it isn't possible to tell with the current UI, but the puzzle submission has all the tetraloops locked into a GAAA sequence.",
"created":"15 May 2013",
"picture":"sites\/default\/files\/pictures\/picture-57675.png"
}
],
"num_synthesized":40,
"follow":[
{
"nid":"2857463",
"uid":"57675",
"id":"2857430",
"updated_time":"1368649258",
"expired_time":null,
"type":"node"
}
],
"num_slots":"40",
"sum_picks":"40",
"num_solutions":"3",
"my_votes":"8",
"uid":"57675"
},
"cached":true,
"memcache":true
}
==Notes==