User talk:ElNando888/Self-interacting sequences

From EteRNA WiKi
Jump to: navigation, search

 

 

Contents

Documented candidates

Candidate 1

Raw data

Sequence AAGUGAACUAUGGGAGCCCUGGGAGGCUCCUCCUGCUGUUCCCAGACAGCAAAAGCCUGUUGG  
MFE
(Vienna 2.1.1) 

..........(((((((..((((((....))))))..)))))))..(((((......))))).

-21.7
Fully constrained

..................xxxxxx...............xxxxxx..................

...........(((((((......)))))))..((((((......))))))............

-19.4
Constraint hairpin 1

..................xxxxxx.......................................

...........(((((((......)))))))..(((((((....)))))))............

-20.5
Constraint hairpin 2 

.......................................xxxxxx..................

...........(((((((......)))))))..((((((......))))))............

-19.4
Hairpins seq. paired

..................((((((...............))))))..................

..................(((((((((.......)))..)))))).(((((......))))).

-15.8

 

2D and 3D shots

(coming soon)

 

Comments

  • The delta between the MFE and the hairpins form is both low (hopefully helping the targeted 'pseudo-switching' behavior) and large enough to make it clear that the experiment failed if the 'pseudo-switching' should not occur at all.
  • The formation of either of the hairpins (and its possible kissing complex forming) should result in the other hairpin forming as well.
  • The form with the hairpin sequences forming a stack is comparatively unlikely (high kcal delta)

 

 

Other examples

(need re-analysis)

 

Candidate 1

Sequence AAACAGUUGGCUUGAGCCCUGGGAGGCUCUGAGGCUGUUCCCAGACAGCUGAGGGUGGCCAUC
MFE
(Vienna 2.1.1) 
.......(((((...(((((.((..(.((((.((.....)))))))..)).))))))))))..
Constrained folding .......(((((..((((......))))((..((((((......))))))..))..)))))..

 

Pseudo-switch.png

 

Coaxial stacking predicted for the constrained form:

Pseudo-switch1-coax1.png Pseudo-switch1-coax2.png

 

 

Candidate 2

Sequence AUGCUUCCCCUGGGAGCCCUGGGAGGCUCACAGGCUGUUCCCAGACAGCACGGCAAAUAAGGU
MFE
(Vienna 2.1.1) 
.((((....((((((((((((.........))))..))))))))..)))).............
Constrained folding .((((....(((.(((((......))))).)))(((((......)))))..))))........

 

Pseudo-switch2.png

 

Candidate 3

Sequence AGUAAUCGAAUAUGAGCCCUGGGAGGCUCUGUUGCUGUUCCCAGACAGCGUCCCUGGCUCUAG
MFE
(Vienna 2.1.1) 
.............(((((..((((.((((((..........))))..)).)))).)))))...
Constrained folding ........((((.(((((......)))))))))(((((......)))))..............

 

Pseudo-switch3.png

 

Candidate 4

Sequence GCGAAGGGAUAAUGAGCCCUGGGAGGCUCCUUGGCUGUUCCCAGACAGCAAAAUGAGUAUUUU
MFE
(Vienna 2.1.1) 
((...((((.....((((..((((...)))).))))..)))).....))..............
Constrained folding .........(((.(((((......))))).)))(((((......)))))..............

 

Pseudo-switch4.png

 

Candidate 5

Sequence CGUCCCGCUUGUCGAGCCCUGGGAGGCUCUGGCGCUGUUCCCAGACAGCUGUCCCAUGGAAUG
MFE
(Vienna 2.1.1) 
......((((...))))(((((((((((((((........)))))..))).))))).))....
Constrained folding ..........((((((((......))))).)))(((((......)))))..(((...)))...

 

Pseudo-switch5.png


Coaxial stacking predicted for the constrained form:

Pseudo-switch5-coax1.png Pseudo-switch5-coax2.png

 


Candidate 6

Sequence UUAAGAACCGAGGGAGCCCUGGGAGGCUCGGUCUGCUGUUCCCAGACAGCCGUAGAAAGAAAC
MFE
(Vienna 2.1.1) 
.......((.(((....))).))...(((((.((((((....))).)))))).))........
Constrained folding ...(((.((....(((((......))))))))))(((((......))))).............

 

Pseudo-switch6.png


Coaxial stacking is not predicted to occur, but the hairpins (marked in white) seem to be predicted to stay distant from each other.

Pseudo-switch6-nocoax.png
Personal tools
Main page
Introduction to the Game