User:ElNando888/Blog/PMP22

Some day, EteRNA will venture into the realm of RNA experiments in vivo. That day may still be far, but that doesn't mean that we can't prepare for it.

Introduction

Recently, someone offered me to work loosely on a specific human gene. I think this will be a perfect opportunity to gather information about the process(es) which transform a gene into products used by the cell.

For now, I will mostly be gathering links, some of a general nature about the processes, some as specific as possible about PMP22.

Links collection

General

From DNA to pre-mRNA: transcription

From pre-mRNA to "mature" mRNA (transcripts): splicing

http://en.wikipedia.org/wiki/RNA_splicing
http://www.dnalc.org/resources/animations/rna-splicing.html
http://www.dnalc.org/view/16938-3D-Animation-of-RNA-Splicing.html
http://en.wikipedia.org/wiki/Shine-Dalgarno_sequence
Off-topic for the human genome, but good to know I think
http://en.wikipedia.org/wiki/Kozak_consensus_sequence

Nuclear transport

Myelin specific

Discussion

First impression? Man, that's so huge and complicated...

Ok, let me see if I understand at least something from this mountain of data:

The DNA gets transcribed. Ok, we end up with a 35549 bases long pre-mRNA. And we're still in the nucleus.

I see no references to Group I, II or III introns, so I assume that the editing is done the "classical" way, with spliceosomes.

Let's focus on transcript 1. The exons are:

CAGUUACAGGGAGCACCACCAGGGAACAUCUCGGGGAGCCUGGUUGGAAG
CUGCAGGCUUAGUCUGUCGGCUGCGGGUCUCUGACUGCCCUGUGGGGAGG
GUCUUGCCUUAACAUCCCUUGCAUUUGGCUGCAAAGAAAUCUGCUUGGAA
GAAGGGGUUACGCUGUUUGGCCGG
GCAGAAACUCCGCUGAGCAGAACUUGCCGCCAGAAUGCUCCUCCUGUUGC
UGAGUAUCAUCGUCCUCCACGUCGCGGUGCUGGUGCUGCUGUUCGUCUCC
ACGAUCGUCAGC
CAAUGGAUCGUGGGCAAUGGACACGCAACUGAUCUCUGGCAGAACUGUAG
CACCUCUUCCUCAGGAAAUGUCCACCACUGUUUCUCAUCAUCACCAAACG
AAUGGCUGCAGUCUGUCCAGGCCACCAUGAUCCUGUCGAUCAUCUUCAGC
AUUCUGUCUCUGUUCCUGUUCUUCUGCCAACUCUUCACCCUCACCAAGGG
GGGCAGGUUUUACAUCACUGGAAUCUUCCAAAUUCUUGCUG
GUCUGUGCGUGAUGAGUGCUGCGGCCAUCUACACGGUGAGGCACCCGGAG
UGGCAUCUCAACUCGGAUUACUCCUACGGUUUCGCCUACAUCCUGGCCUG
GGUGGCCUUCCCCCUGGCCCUUCUCAGCGGUGUCAUCUAUGUGAUCUUGC
GGAAACGCGAAUUGAGGCGCC... (about 1130 more nts)

The Kozak sequence is visible in exon 2. According to the Wikipedia article, it is "adequate", since position -3 is a purine, but position +4 is not G. If I understand correctly, this means that the gene is not an overly highly expressed one...

At this point, I have already given a large amount of thought as to how these RNA segments may have folded during their stay in the nucleus. But it occurs to me that the translation occurs in the cytoplasm, where the ribosomes are located. One way or the other, this mature RNA has to cross over, and if my memory (and logic) serves me well, there should be a membrane between these two spaces... Which brings me to this point: whether or not the RNA has folded before being edited or not, refolded after the spllcing or not, it is very likely that the molecule has to unfold completely and cross the membrane nucleotide by nucleotide, meaning that a refolding in the cytoplasm space would follow rules similar to the transcriptional ones... The problem is, I just don't know the first thing about this stage. How does RNA travel out of the nucleus? In which conditions? If the crossing-over is as I think single-stranded, which end goes first, 3' or 5'? Does anyone have a pointer to resources on the subject?

Update: after some googling, I found some answers (links above). If I understand correctly, the mature mRNA gets packaged with proteins into something called mRNP. This mRNP is driven to special gates called PNC. The mRNP "enters" the PNC as a globular block. Then the mRNP complex emerges into the cytoplasm, apparently unfolded (unfolding), starting by its capped 5' end. I still have no information as its speed, the rate and speed of disassembly mRNP → mRNA + proteins, and how fast ribosomes typically bind the capped 5' end and start scanning...