Reproducibility Test Lab

From EteRNA WiKi
Jump to: navigation, search

 [http:  LabName] representative.
Round N. ID=[http: DesignID].
Score = NN.

The Reproducibilty Test Lab is a special lab that is (will be) synthesized in each synthesis round.  The objectives for this lab are:

  • Provide a consistent measure of the reproducibilty of the cloud lab synthesis results, for long term quality control,
  • Determine how much of the variation in synthesis results is captured by the error estimates reported for each synthesized base,
  • Provide some guidance as to where the synthesis process might be improved, in order to increase reproducibility, and
  • Give those analysing the synthesis data a better understanding of the variation to expect when comparing data from different synthesis rounds.

 

Initial Sequences

Sequence Description or rationale for inclusion
Original SHAPE data, or expected folding

AGUCAUCUAC UACGAAAAAC ACAUUCUAUU CGAAAACGAA UAGAAUGUGU CGUAGUAGAU GAC

Cloud Lab 1 representative. Round 1. ID=2366937.
Score = 94.

SHAPE 2366937.png
GCAAGGACGA AUAAGCCAUA ACCGCAGGGA AACACUGAAC GGAGCCGAAA GAGCAAGCAA UAA

Cloud Lab 4 representative. Round 2. ID=2655773.
Score = 88.

SHAPE 2655773.png
GAGAUGGGUA ACGAAAGUUG CGCUGCCGAA UGAAAGUUCU GGAUGAAAGU CUGGUGGCCU AUC  Cloud Lab 9 representative. Round 2. ID=2588792.
Score = 78.  High GU content.

AGAGUGAAGG ACGGAGAAUC UCCGUCGUCG CGAAGCGGCC CUGGGCUUCC CAGGCUUCAC UCA  Cloud Lab 15 representative. Round 1. ID=2337872.
Score = 96.
 
GAGAUAUUAU AAUAUUAUAA UAUGCAAAGA AAUAAGAAGC AUAUUAUAAU AUUAUAAUAU CAA  Cloud Lab 18 representative. Round 2. ID=2596919.
Score = 98.  High AU count.
 
GCGGAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAC CGC  Clouud Lab 19 representative. Round 1. ID=2339041.
Score = 92.  Big loop of all A.
 

GCGGCGGCAA AGGCGGCGCA ACGCGGCGGA AAAUCGGCGG CGACGCGGCG GAAAUCGGCG GCG

Cloud Lab 20 representative. Round 1. ID=2335964.
Score = 91. Lab has lots of 1-1 loops.  Sequence is Christmas tree that scored well.
 

GUACAAAUCC UCGAAAACUC GAGGAUAUAU CAAAAGAUAG AAGGCGAGAA AAAAAGGAGG UAC

Hair Trigger representative. ID=2433439. From switch lab, with a similar estimated MFE between the two states (without aptamer.)  

AAAAAGCUCC AUGAGGAUAU AGAGCAGAAA AUAUGCCUAG AAGGCAUGGU AAAAUAGCAA AAA

LS2 representative. ID=2435428. Switch lab.  Good scores in both states. State 1 not predicted to be MFE by Eterna energy model.
 

UAAGCACCAG GAGCAGGACC AGCGAAACAA AACAAACAAA GCAGGACCAG CACCAGGAGC AAA

Ball and Chain representative. ID=2763519. Score = 96.  Systematic testing of CG bases anchoring 1-1 loops with both As.
 

GAGCUAGUGC UGAGGAAACU UAGCCUAGCU CAGAUUUGCC UAAUCGAAAG AUUAGUGCAG AUC

RNA Bridge representative.  ID=3006655. Score = 77.  Good dot plot and melt plot, but low score.
 
  LabName representative. Round N. ID=SOLNNNN. Score = NN.  
  LabName representative. Round N. ID=SOLNNNN. Score = NN.  

GACGCCGAUG GUAGCAAGGG AAACCGAGGA AACUCGCGAA AGCAAAGCGA GAGUAGGAAA GUC

Huffman. ID=2736789. Score = 96. Sequence apperared to have stable stack including non-canconical pairs.
 

AGAGUGAAGG ACGCCGUUUC GGCGUCGUGC CCUUGGCACC CUCCCGAAGG GAGGCUUCAC UCA

Triloop Buffet. Round 2. ID=2676335. Score = 91. Sequence apperared to show tertiary bonding.  
     
     
     
AUCGAAAGAU Very short sequence
 

UAGCAGGGCUAGCUAGCUUGGCAAAAUUCGACGUAAGCAAAAUGCAAAAAACGUAUCGAUUAUAUUGAAAAAGAUCGGACUAGGCUAGG

Maximum length (89) sequence

 
GCGAUGCGGAUACGAAAGUAUCGGCAUCGC

 

Project: Comparison Series: 1-1. ID=748766. Score = 86.
 aa
GCGAUGCGGAUACGAAGUAUCGGCAUCGC

 

Project: Comparison Series: Triloop. ID=749314. Score = 93.  aa
GCGAUGCGGAUACGAAAAGUAUCGGCAUCGC

 

Project: Comparison Series: Pentaloop. ID=749321. Score = 96.  aa
GCGAUGCGGAUACGAAAAAGUAUCGGCAUCGC Project: Comparison Series: Hexaloop. ID=749326. Score = 100.  aa
     
     
     

 

rhiju → Omei:  please submit up to 40 sequences, this weekend if possible!

Omei → rhiju:  Will do. Am I correct in thinking that can refine the set over time, if we decide we would benefit from different sequences?

rhiju → Omei:  yes of course. I think we're granting you (and the players you represent) a 'standing order' of 40 sequences over each cycle to characterize errors and to make suggestions to us devs for viewing & experimental improvements. I'm excited to see what you find!
Personal tools
Main page
Introduction to the Game