Puzzle Walkthroughs/Basic Switch Walkthrough (chatlog)

From EteRNA WiKi
Jump to: navigation, search

Chat log captured on Dec 24th 2012

 

   
Kalas Am I the only one having trouble with switches?
rnjensen45 kalas,... join the club
rnjensen45 :)
Quxwozing yeah
rnjensen45 Based on the number of solvers on most switch puzzles, Ii believe it to be a very large club of us mere mortal solvers...
Kalas Never paid attention, I'll take a look. ;-)
jmf028 i'm not one of em :)
jmf028 mere mortals i mean
rnjensen45 jmf, you're too humble...
jmf028 :D
jmf028 sorry
rnjensen45 jmf, when are you going to do a guide for solving switches
jmf028 merry christmas
jmf028 as soon as i finish this switch
rnjensen45 cool
jmf028 if you want I can show you right now
rnjensen45 \
rnjensen45 cool
jmf028 id rather not make a written guide
rnjensen45 understand
jmf028 okay so lets start with basic switch first
jmf028 have you solved that yet?
rnjensen45 ok
rnjensen45 yeah, I actually have 4 or 5 solved. and another 4 close.
rnjensen45 my problem is I get close, and can't figure how to finish
jmf028 okay well lets go to one you haven't tried yet
jmf028 ill guide you through how i solve it
rnjensen45 perfect
jmf028 and don't pick the jet plane or the only 13 solved ones
rnjensen45 :D wouldn't do that
jmf028 okay tell me when you found one
rnjensen45 actually, can you give me a hint on how I would go about getting this one completed
rnjensen45 http://eterna.cmu.edu/sites/default/files/chat_screens/60391_1356385525.png
jmf028 alright hold on
Kalas hey
Kalas I could use a hand here too
rnjensen45 I think I have 3 that are about this close... I get to here and can;t figure out. Kalas: CUGAGGAUAUGGAAAACUAGAAGGCGGCACACACACAACACCU
Kalas uhghh
rnjensen45 sorry kalas, good point, we should
Kalas http://eterna.cmu.edu/sites/default/files/chat_screens/11100_1356385575.png
rnjensen45 lets do one from the start so this isn't so one sided.
rnjensen45 my mistake, sorry kalas
jmf028 oh i see
jmf028 ok lets go to that one
rnjensen45 ok
jmf028 alright ready guys?
Kalas Yep
Kalas I am
Kalas ;-)
jmf028 cool alright so first we fill in the locked bases partners
jmf028 start with locked Adenine
jmf028 http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356385708.png
Basic switch walkthrough chatlog 1.png
jmf028 should look like that
Kalas ahhh
jmf028 the reason this is the first base you start filling in is because it is the only possible pair you can make with a locked Adenine
Kalas So i need to do it over again?
jmf028 now
jmf028 yes kalas
Kalas ok
Kalas sad
Kalas give me a sec
jmf028 if you want to follow this guide correctly
Kalas done
rnjensen45 me too
jmf028 okay so now, do you know how to highlight a base?
Kalas no
rnjensen45 yes
rnjensen45 control click
jmf028 hold cntrl for pc and command for mac and click on base
jmf028 click on the U you just filled in
Kalas k
jmf028 is it highlighted with black circle?
Kalas yes
jmf028 good
jmf028 now
jmf028 switch to other structure
Kalas Im doing it in PiP
jmf028 http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356385920.png
Basic switch walkthrough chatlog 2.png
jmf028 oh well then don't
Kalas i see it
jmf028 you need to have this one as it allows you to highlight
jmf028 otherwise you will have to highlight both structures
Kalas okay, i'll do that
jmf028 don't get me wrong sometimes PiP mode is necessary
Kalas you're right
jmf028 but for now lets keep it simple
Kalas okay
jmf028 okay so the U is in a loop right?
Kalas yup
jmf028 in this case no pair is to be had in this structure with that U
jmf028 so......
jmf028 unhighlight
jmf028 XD
jmf028 not a word but whatevs
Kalas Following instructions
jmf028 switch back
jmf028 now we will fill in bases next to locked Gs
Kalas ok
jmf028 do you understand why Gs are a little different than As
rnjensen45 yep 2 choices
jmf028 gj rnj
Kalas A only match with U?
jmf028 correct
jmf028 well here is my solution
jmf028 dont worry about choice right now
jmf028 only use GCs
rnjensen45 makes sense
Kalas To keep 1 choice
jmf028 so next to Each one, use a C
Kalas done
jmf028 and then highlight both
rnjensen45 done
jmf028 then switch
Kalas done
jmf028 http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356386202.png
Basic switch walkthrough chatlog 3.png
jmf028 should look like this so far
Kalas yup
jmf028 good
jmf028 switch back
Kalas done
jmf028 now usually when no more locked bases, you have to guess
jmf028 but here is my strategy
jmf028 GCs at loop-stack intersections
jmf028 AUs between loops
jmf028 so check this out
Kalas thats my strat so far
rnjensen45 do you have a preference on orientation GC or CG
jmf028 http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356386327.png
Basic switch walkthrough chatlog 4.png 
Kalas follow the locked pattern
jmf028 in this case
rnjensen45 what I have
jmf028 this is the best energy orientation for the puzzle
jmf028 so far.....
jmf028 so
rnjensen45 agreed
jmf028 now you have to highlight both bases in each pair
jmf028 switch then
jmf028 http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356386394.png
Basic switch walkthrough chatlog 5.png  
jmf028 should look like this
rnjensen45 let me guess, the next step is to put a G in 2
jmf028 yep exactly :)
jmf028 but here is where you start having fun
Kalas g in 2?
jmf028 once you put the G there, switch highlighted C to to the G you just put
rnjensen45 yep, Up to this point I am good... it is from here...
rnjensen45 Kalas, next to the circled C
rnjensen45 http://eterna.cmu.edu/sites/default/files/chat_screens/60391_1356386503.png
jmf028 correct
Kalas oh
Kalas ok
jmf028 but remember to switch the highlighted portion from the C to the G and from the U to the already bonded A
jmf028 and unhighlight the A and G in the loop
jmf028 then switch
jmf028 http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356386581.png
 Basic switch walkthrough chatlog 6.png
jmf028 should look like this
Kalas indeed
rnjensen45 yep
jmf028 unhighlight those two bases now, and you have all the bases paired in one structure now
jmf028 now lets work on the other structure
jmf028 switch
jmf028 there are three still unpaired bases in this puzzle
Kalas http://eterna.cmu.edu/sites/default/files/chat_screens/11100_1356386666.png
jmf028 so remember what i said about intersections and in between the loops?
Kalas Yes
jmf028 EXACTLY
jmf028 good job
jmf028 how does the other one look?
Kalas bad XD
jmf028 okay well hold on
jmf028 http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356386728.png
  Basic switch walkthrough chatlog 7.png
jmf028 here is a good structure that keeps the first one stable
jmf028 this is not stable
jmf028 but it is all paired
rnjensen45 agreed
jmf028 all 6 of the base pairs need to be highlighted and paired up in other structure
jmf028 but since other structure is stable, it looks like they already are :)
jmf028 also, when switched again:
rnjensen45 so now we need to deal with energy of the structures w/ and w/o the molecule
jmf028 http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356386835.png
Basic switch walkthrough chatlog 8.png
jmf028 notice the G that just so conveniently fell into the boost base near the GC at loop
Kalas yes
rnjensen45 was just looking at that
jmf028 :)
jmf028 that is not always what happens
jmf028 but still it is good XD
jmf028 unhighlight all the bases and now we are on to the switching back and forth part
rnjensen45 k
jmf028 now lets go to the unstable structure
jmf028 http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356386985.png
Basic switch walkthrough chatlog 9.png
jmf028 notice the end loop has no boost G
Kalas indeed
jmf028 lets try inserting one and see what it does to brother structure
Kalas makes it unstable
jmf028 well thats not good
jmf028 but hold on
jmf028 you can go backwards to undo but lets try something
jmf028 http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356387065.png
Basic switch walkthrough chatlog 10.png
jmf028 in this state here:
jmf028 lets try messing around with loop
jmf028 one at a time substitute an A for a non A
jmf028 if it does not stabilize, undo
jmf028 ready go
Kalas it did
jmf028 good which one
Kalas http://eterna.cmu.edu/sites/default/files/chat_screens/11100_1356387140.png
Kalas below a g at the right
rnjensen45 got the same result
jmf028 hold on something is weird
jmf028 why is yours different
jmf028 http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356387203.png
Basic switch walkthrough chatlog 11.png 
jmf028 this is mine
Kalas weird
jmf028 ?
jmf028 haha
rnjensen45 we both changed 14 to U
Kalas What about you jensen?
rnjensen45 when you said to switch A to non-A in loop
jmf028 oh
Kalas yup
rnjensen45 we started with 14
Kalas 16 i think
jmf028 i meant change non A to A
jmf028 sorry
Kalas oh!
rnjensen45 NP
jmf028 just go to this solution
jmf028 http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356387303.png
Basic switch walkthrough chatlog 12.png
jmf028 or sequence
jmf028 not solution yet
rnjensen45 so changing 12 to A also stabilizes
jmf028 correct
jmf028 now unhighlight G and highlight.....?
Kalas http://eterna.cmu.edu/sites/default/files/chat_screens/11100_1356387361.png
jmf028 which one are you now going to highlight?
rnjensen45 better, we change to A because it connects to fewer
Kalas I think i fail to understand this part
jmf028 okay hold on kalas
jmf028 switch from non A to A
rnjensen45 17 changes to U
jmf028 but ONE at a TIME
jmf028 so if it doesn't stabilize.....
Kalas o
jmf028 then undo and try another one
jmf028 does that help?
Kalas so we make a change in the unstable
rnjensen45 sorry, got ahead of you and am now lost...
Kalas if it affect the first one
jmf028 correct
rnjensen45 ahead
Kalas we go and change a non-a
Kalas to a
jmf028 http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356387494.png
Basic switch walkthrough chatlog 13.png
jmf028 so here is what it should look like Kalas
jmf028 and this is after i changed a C to an A
Kalas it does right now
Kalas yup got back to this point
jmf028 base 12
jmf028 highlight this A and unhighlight the G from before if you haven't already
rnjensen45 k
jmf028 you good kalas?
Kalas yup
jmf028 ok now switch
jmf028 what should you do now?
rnjensen45 17 to a U
Kalas so i need to change the g to a u?
jmf028 good job
jmf028 and what do you do with highlighting part
Kalas highlight u
rnjensen45 unhighlight A highlight U
Kalas switch
jmf028 good job
jmf028 and yes switch
jmf028 now the U is destabilizing
rnjensen45 :)
Kalas change non-a to a
jmf028 what do we do
jmf028 good job kalas
jmf028 now in this case, why won't changing G be good
jmf028 not first but bottom G
rnjensen45 isnt that the one we just did the time before?
jmf028 correct
jmf028 so skip that and try the last one you can
rnjensen45 #13
jmf028 right rnj that should stay the same
rnjensen45 so do we change #18 from U to A
jmf028 correct rn
Kalas no
Kalas uhh
jmf028 what up kalas
Kalas How can i see the numbers when i want ?
jmf028 oh gears below
rnjensen45 first check box
Kalas so much better
Kalas thanks
rnjensen45 show nuc.. numbers
jmf028 np
jmf028 okay here is what it should look like so far
jmf028 http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356387860.png
Basic switch walkthrough chatlog 14.png
Kalas number 18 switched
jmf028 now switch
jmf028 yep kalas
jmf028 do you understand why tho
Kalas stabilised the first one
jmf028 right but why 18 and not 13
Kalas we added 13 no?
jmf028 correct
jmf028 now from here you can switch back
Kalas should we highlight it to remember not to touch it anymore?
jmf028 no because it gets even more confusing
Kalas ok
jmf028 trust me i tried that before
jmf028 it makes you think you should change it's base pair
jmf028 now, with this part do the same thing until you get to another loop in one of the structures
rnjensen45 thx, I was stuck in that recursive he**
jmf028 haha
rnjensen45 so U in 18
Kalas so
Kalas Can i change number 17 to a?
jmf028 try not to yet
jmf028 hold on
rnjensen45 sorry, U in 11
jmf028 all right
jmf028 notice nothing more works other than what we have already tried
jmf028 so lets undo until everything pairs and the first structure is stabilized :)
jmf028 this is what we call a trial and error error
jmf028 but we learned something from it
rnjensen45 ok, so effectively we try this pattern to its normal conclusion, which is eiher a solve or a dead end
jmf028 well sometimes rn
jmf028 but just looking to boost one side without effecting the other [11:36 PM]
jmf028 in this case it didn't work
jmf028 but its good to know that trick
jmf028 becomes useful in the bigger switches
jmf028 alright should look like this
jmf028 http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356388230.png
Basic switch walkthrough chatlog 15.png
rnjensen45 yep,
jmf028 kalas you good?
Kalas yes
jmf028 okay now be in the same state as this last picture
Kalas just done it
jmf028 look up at the top where it shows an instability in the loop
jmf028 oh kalas you finished?
Kalas no
jmf028 ok
Kalas jim at your state
Kalas thats what i said
Kalas meant
jmf028 okay
Kalas what i meant
Kalas *
jmf028 so as i said before notice instability in the loop
jmf028 the open loop
jmf028 not the middle one
rnjensen45 k
jmf028 lets get rid of that shall we
jmf028 what do we start doing first
Kalas change g number 12
Kalas to a
Kalas ?
Kalas Highlight a?
jmf028 correct
jmf028 notice how that was all you needed to do to stabilize it
Kalas yep
jmf028 now switch and do keep making changes til you get to another loop
jmf028 op
jmf028 we did it
jmf028 its solved
jmf028 anyone else solve it?
Kalas nope, trying
jmf028 well if you changed the G to an A at the bottom?
rnjensen45 not yet...
jmf028 http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356388571.png
Basic switch walkthrough chatlog 16.png
jmf028 that was from the change
jmf028 here is what we started with
jmf028 http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356388601.png
Basic switch walkthrough chatlog 17.png
jmf028 rn didn't you say change the G to an A
Kalas oh
Kalas it worked
jmf028 did you solve it?
Kalas yeah
jmf028 gj kalas
rnjensen45 sorry, I lost you somewhere, give me a minute
jmf028 rn start with this sequence
jmf028 http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356388675.png
Basic switch walkthrough chatlog 18.png
Kalas so this is the easiest switch?
Kalas This is hell haha
jmf028 correct kalas
rnjensen45 :D
jmf028 well you get used to it
jmf028 did you solve it rn?
Kalas But with those tricks, i think i get it
jmf028 thats great kalas
jmf028 hope that helped
Kalas Thanks jmf! ;-)
jmf028 there are more tricks but they vary in difficulty and your welcome :)
jmf028 rn did you solve it?
rnjensen45 no I am lost
rnjensen45 http://eterna.cmu.edu/sites/default/files/chat_screens/60391_1356388815.png
jmf028 start from the sequence i gave you
openatheclose Finishing puzzles with 0/18 GC pairs. #YOLO
jmf028 okay now try switching
jmf028 rn that should actually be a solution my bad
jmf028 didn't mean to show solution
jmf028 forgot to also change back the U i added
jmf028 so i gave you answer XD
jmf028 anyway rn you understand it i think
jmf028 did the tutorial help at least?
rnjensen45 yes, I will give this out... not sure how I lost you at the end...
rnjensen45 the tutorial was really good.
jmf028 good i'm glad
rnjensen45 What I struggle with is I can get close, but didn't have a plan for the end game.
jmf028 yeah that is the fun part for me
rnjensen45 one struggle is when both puzzles resolve to the same shape because energy isn't right ie molecule doesn't move it
jmf028 right
rnjensen45 actually had jet plane to that point, but lost it trying to get energy balanced
jmf028 that's actually the reason jet plane is so hard
jmf028 it does that alot
Jieux why is jet plane so hard?
jmf028 joke detected
jmf028 answer because it is compiling
Tesla'sDisciple jet plane was hard?
jmf028 oh you guys are too much
Jieux I have yet to solve it.
Jieux and I'm not doing any switches til I do.
jmf028 well that is a switch
jmf028 and therein lies your dilemma
Jieux any other switches silly.
jmf028 :D
Jieux 8P
jmf028 did you guys have any other things you would have liked to add to that tutorial?
Jieux what tutorial?
jmf028 the tutorial i just gave for switches
Tesla'sDisciple you did a great job jmf
rnjensen45 agreed, thx again...
Kalas yeah thanks!
Tesla'sDisciple like you said, there are some other advanced tricks, but you need to get some switches under your belt first
   
Personal tools
Main page
Introduction to the Game